.gif)
Haplogroup I1 (Y-DNA)
Encyclopedia
In human genetics
, Haplogroup I1 is a Y chromosome
haplogroup
occurring at greatest frequency in Scandinavia, associated with the mutations identified as M253, M307, P30, and P40. These are known as single nucleotide polymorphisms (SNPs
). It is a subclade
of Haplogroup I
. Before a reclassification in 2008, the group was known as Haplogroup I1a. Some individuals and organizations continue to use the I1a designation.
The group displays a very clear frequency gradient, with a peak of approximately 40 percent among the populations of western Finland
and more than 50 percent in the province of Satakunta, around 35 percent in southern Norway
, southwestern Sweden
especially on the island of Gotland
, Denmark
, and northern Germany
, with rapidly decreasing frequencies toward the edges of the historically Germanic
sphere of influence.
(LGM) the predecessors of the I1 group sought refuge in the Balkans
. For a time, Ukraine was considered as an alternative. Yet, The Genographic Project
claims that the founder of the I1 branch lived on the Iberian Peninsula during the LGM. Some have given southern France and the Italian peninsula as possible sites as well. Although the locations vary, proponents of the refuge theories do seem to agree on one issue: that the I1 subclade
is from 15,000 to 20,000 years old.
Ken Nordtvedt
of Montana State University
believes that I1 is a more recent group, probably emerging after the Last Glacial Maximum
LGM. Other researchers including Peter A. Underhill of the Human Population Genetics Laboratory at Stanford University
have since supported this hypothesis in independent research.
The study of I1, which some had argued was largely ignored by the genetic testing industry in favor of "mega-haplogroups" like R, is in flux. Revisions and updates to previous thinking, primarily published in academic journals, is constant, yet slow, showing an evolution in thought and scientific evidence.
According to Nordtvedt, most recent common ancestor
(MRCA) of I1 lived from 4,000 to 6,000 years ago
somewhere in the far northern part of Europe, perhaps Denmark
. His descendants are primarily found among the Germanic
populations of northern Europe and the bordering Uralic and Celtic populations, although even in traditionally German
demographics I1 is overshadowed by the more prevalent Haplogroup R
.
When SNPs are unknown or untested and when short tandem repeat
(STR) results show eight allele repeats at DYS455, haplogroup I1 can be predicted correctly with a very high rate of accuracy, 99.3 to 99.8 percent, according to Whit Athey and Vince Vizachero. This is almost exclusive to and ubiquitous in the I1 haplogroup, with very few having seven, nine, or another number. Furthermore, DYS462 divides I1 geographically. Nordtvedt considers 12 allele repeats to be more likely Anglo-Saxon and on the southern fringes of the I1 map, while 13 signifies more northerly, Nordic origins. Nordtvedt has repeatedly argued that, at least for I1, SNP testing is generally not as beneficial as expanded STR results.
Note: The systematic subclade names have changed several times in recent years, and are likely to change again, as new markers which clarify the sequence of branchings of the tree are discovered.
, distribution of Haplogroup I1 is closely correlated with Haplogroup I2a1, but among Scandinavians including both Germanic and Uralic peoples of the region nearly all of the Haplogroup I
chromosomes are I1. It is common near the southern Baltic and North Sea coasts, although successively decreasing the further south geographically. The Migration Period
or "wandering of peoples" may explain the dispersion of I1 into areas beyond northern Europe.
The traditional view of British and Irish prehistory was that several waves of migration had resulted in widespread, if not total, population displacement. After the Last Glacial Maximum
the region was first repopulated by Paleolithic
hunter gatherers. During the Neolithic
period, with the spread of farming, this population was supposedly replaced by the farmers. Later immigrations were thought to have accompanied the transitions to bronze and iron-working, known respectively as the Bronze
and Iron Age
s. The introduction of iron was particularly significant because archaeologists had associated it with the Hallstatt
and La Tène culture
s. These came to be associated by early archaeologists with the so-called Celtic culture, which was seemingly widespread on the continent. A later migration, that of the Anglo-Saxons
, was also claimed to have led to total population replacement, but genetic evidence suggests otherwise. In his Ecclesiastical History of the English People
, Bede
claimed that the Angles
came to Britain en masse as an entire nation leaving no one behind in their homeland Angeln
. Other population movements (though not total displacements) recorded during historical times include those of the Danish and Norwegian Viking
s, Danes in the east of England (especially the Danelaw
) and Norwegians in the Shetland and Orkney Isles, Western Isles and Ireland
.
The replacement model has been under sustained attack since the 1960s, with researchers asserting a much greater continuity than previously known or acknowledged. British archaeologist Simon James
attributes the idea of large-scale mass migration to the assumption of primitivism about earlier inhabitants, assuming that cultural changes, such as nomadic hunter-gathering to farming, stone-working to metalworking, and bronze-working to iron-working, required newcomers introducing materials and techniques to the indigenous population, rather than them learning through trade or other methods.
Francis Pryor
has stated that he "can't see any evidence for bona fide mass migrations after the Neolithic
." Historian Malcolm Todd
writes, "It is much more likely that a large proportion of the British population remained in place and was progressively dominated by a Germanic aristocracy, in some cases marrying into it and leaving Celtic names in the, admittedly very dubious, early lists of Anglo-Saxon dynasties. But how we identify the surviving Britons in areas of predominantly Anglo-Saxon settlement, either archaeologically or linguistically, is still one of the deepest problems of early English history." Although the idea of mass human migrations into Great Britain and Ireland is now a relatively minor point of view amongst British and Irish archaeologists, there is still a perception outside of the archaeological community that an "Anglo-Saxon" mass migration (especially) occurred, and that this forms a fundamental division between English "Anglo-Saxon" populations in Great Britain and non-English "Celtic" populations.
In 2002 a paper titled "Y Chromosome Evidence for Anglo-Saxon Mass Migration" was published by the Centre for Genetic Anthropology at the University College London
in cooperation with Vrije Universiteit
and the University of California, Davis
claiming direct genetic evidence for population differences between the English and Welsh populations and proposed a model for mass invasion of eastern Great Britain from northern Germany
and Denmark
. The authors assumed that populations with large proportions of haplogroup I originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea
with Anglo-Saxon migrations and Danish Vikings.
In her book Origins of the English Catherine Hills criticized these conclusions, arguing that a biased sampling strategy flawed the study, especially since testing was limited only to regions in England where Danes were known to have settled during the Danelaw, which is archaeologically distinct. In the paper the main claim by the researchers was
The paper was widely publicized in the media, especially in the United Kingdom, but reporting was often misleading and inaccurate. For example, the BBC
claimed that the "English and Welsh are races apart" and asserted "that between 50% and 100% of the indigenous population of what was to become England was wiped out" though this was not a claim of the paper. The conclusion for evidence of mass Anglo-Saxon migration, and that east English samples were more similar to Frisian samples than to Welsh samples, did not support the archaeological orthodoxy of modern times. A year later, in 2003, the paper "A Y Chromosome Census of the British Isles" was published by Capelli et al.. This paper, which sampled Great Britain and Ireland on a grid, found a much smaller difference between Welsh and English samples, and was much more characterised by isolation by distance, with a gradual decrease in Haplogroup I frequency moving westwards in southern Great Britain. It also found North German and Danish samples were not more similar to east English samples than Welsh samples.
Oxford archaeologist David Miles has argued that 80 percent of the genetic makeup of native Britons probably comes from "just a few thousand" nomadic tribesmen who arrived 12,000 years ago, at the end of the Ice Age
. This suggests later waves of immigration may have been too small to have significantly affected the genetics of the pre-existing population.
Traditionally, areas with a majority Angle influence included the Kingdoms of Northumbria (Nord Angelnen, Nordimbria Anglorum), East Anglia
(Ost Angelnen) and Mercia
(Mittlere Angelnen) while the Saxon areas were the Kingdoms of Sussex
(Suth Seaxe), Essex
(Est Seaxna), and Wessex
(West Seaxna). The Kingdom of Kent
was considered a place of another Germanic tribe, the Jutes
. Stephen Oppenheimer
suggested that the Anglo-Saxon invasions actually had been predominantly Anglian.
Meanwhile, Bryan Sykes
has said that the Anglo-Saxons made a substantial contribution to the genetic makeup of England, but probably less than 20 percent of the total, even in southern England, where raids and settlements were supposedly commonplace. His conclusions, on Britain at least, mirror those of other researchers including Siiri Rootsi and Nordtvedt. A report on the Saxons who were part of the Germanic settlement of Britain during and after the fifth century was issued by University College London
in July 2006, with a wide-ranging estimate for the total number of settlers varying between 10,000 and 200,000.
The Vikings, both Danes and Norwegians, also made a substantial contribution after the Angles
, Saxons
and Jutes
, Sykes said, with concentrations in central, northern, and eastern England, territories of the ancient Danelaw
. Sykes said he found evidence of a very heavy Viking contribution in the Orkney and Shetland Islands, near 40 percent. Mitochondrial DNA as well as Y DNA of northern Germanic origin was discovered at substantial rates in all of these areas, showing that the Vikings engaged in large-scale settlement
, Sykes explained. However, Nordtvedt has said that separating I1 haplotypes into Viking and non-Viking groups has been impossible thus far.
Evidence of Norman
genetic influence in England was extremely small – about two percent according to Sykes, discounting the idea that William the Conqueror, his troops and any settlers disrupted and displaced previous cultures. Some notable British historians (and Anglophiles) assumed that the Norman invasion
of AD 1066 greatly affected the society of the time and that little culture survived from the original Britons. In England, from the fifth to seventh centuries, the Anglo-Saxons soon developed their own paganism as well.
The study of languages and place names provides more supporting evidence. For example, Old English emerged from the Anglo-Frisian dialects brought to Britain by Germanic settlers and perhaps Roman soldiers. The convergence of varying languages lends credence to a diverse genetic pool. Initially, the English language
began as a diverse group of dialects reflecting the varied backgrounds of the Anglo-Saxon kingdoms. One of these dialects, Late West Saxon, eventually dominated.
Then two waves of invaders brought new influences. The first was by language speakers of the Scandinavian branch, known as North Germanic. They conquered and colonized parts of Britain in the eighth and ninth centuries. The second was the Normans in the eleventh century, who spoke Old Norman
and ultimately developed an English variety called Anglo-Norman
. These two invasions caused English to become linguistically "mixed" to some degree. English developed into a "borrowing" language of great flexibility with a large vocabulary.
In England the Viking Age
began dramatically on June 8, 793, when Norsemen destroyed the abbey at Lindisfarne, plundering and murdering indiscriminately. An incident four years earlier, in which three Viking ships were beached in Portland Bay, perhaps on a trading expedition, created some tension, but Lindisfarne was different. The devastation of Northumbria's Holy Island shocked many, including the royal Courts of Europe. More than any other single event, the attack on Lindisfarne cast a shadow on the perception of the Vikings for the next twelve centuries.
The Franks
, for whom France
(literally "Land of the Franks") is named, were a Germanic tribe first identified in the third century as an ethnic group living north and east of the Lower Rhine. They founded one of the Germanic monarchies which replaced the Western Roman Empire
from the fifth century. The Frankish state consolidated its hold over large parts of Western Europe by the end of the eighth century. The Carolingian Empire
and its successor states were Frankish. French nobility were often descended from Frankish
and Norman
Germanic lineages and often bore Germanic names such as Charles de Gaulle
, though his family Y chromosome
DNA
has not been tested. The name “de Gaulle” likely came from “De Walle” which in German means “the wall" of a fortification or city.
Following the successful example of a Cornish-Viking alliance in 722 at the Battle of Hehil, which helped stop the Anglo-Saxon conquest of Cornwall
at the time, the people of Brittany
(Bretons) made friendly overtures to the Danish Vikings in an effort to counter Frankish expansionism. In 866 the Vikings and Bretons united to defeat a Frankish army at the Battle of Brissarthe
, resulting in formal recognition of Brittany's independence.
The Vikings continued to tactically help their Breton allies by devastating Frankish areas under the Carolingians with pillaging raids. In 885, one of the minor Viking leaders named Rollo
helped in the siege of Paris
under the command of Danish king Sigfred
. When Sigfred retreated in return for tribute the following year, Rollo stayed behind and was eventually bought off and sent to bother Burgundy by the Frankish king, Charles the Simple
. Later, he returned to the Seine with a group of Danish followers who were called "Men of the North" or Norsemen
. They invaded the area of northern France now known as Normandy
.
Rather than pay Rollo to leave, as was customary, Charles the Simple realized that his armies could not effectively defend against the raids and guerrilla tactics, and decided to appease Rollo by giving him land and hereditary titles under the condition that he defend against other Vikings. Led by Rollo, the Vikings settled in Normandy after being granted the land. They subsequently established the Duchy of Normandy
. The descendants who emerged from the interactions of Vikings, Franks, and Gallo-Romans became known as Normans. This may explain why a noticeably higher than average rate of men living in northwestern France today are I1.
The Scandinavian colonisation of Normandy
was principally Danish, complemented by a strong Norwegian contingent, although a few Swedes were present. The Viking colonization was not a mass phenomenon, but they established themselves rather densely in some areas, particularly Pays de Caux
and the northern part of the Cotentin. Toponymic and linguistic evidence supports this theory. The merging of the Scandinavian and native populations contributed to the creation of one of the most powerful feudal states of Western Europe. The naval ability of the Normans
would allow them to conquer England, and participate in the Crusades
.
by the Byzantines. The Varangians have been described as a warrior elite or nobility.
Varangian leader Rurik
is credited with founding the first Rus state. Although recent genetic studies have identified two major lines within Rurikids, N1c1a
and R1a, genetic research shows significant I1 contribution centering on Moscow
.(dead link)
John Haywood, author of The Great Migrations, believes that a group known as the Rus
preceded the Varangians. However, most identify the Rus people as a particular Varangian tribe. A large burial mound in Novgorod Oblast
, Russia
, known as a tumulus
and dating from the ninth century, is similar to those found in Old Uppsala, Sweden
. It is reportedly well-defended against potential looters and has never been excavated. Local residents refer to it as 'Rurik's Grave'.
Scandinavians remained in control of areas such as Kiev
until at least the mid-eleventh century. They became the nucleus of the Rus state, whose Golden Age in the eleventh and early twelfth centuries came to an abrupt end with the Mongol invasion of 1240.
Their campaigns are commemorated on many runestones in both Norway and Sweden, among them the Greece Runestones
and the Varangian Runestones
. The last major expedition appears to have been the ill-fated expedition of Ingvar the Far-Travelled
to Serkland
, a region southeast of the Caspian Sea
, commemorated by the Ingvar Runestones
. What happened to the men is not known.
military elite for a time. This could be the precursor of spikes in I1 haplotypes in Turkey and Greece near Istanbul
. A military unit known as the Varangian Guard was established by Emperor Basil II
. After Rus military recruits helped him quell a rebellion, Basil II formed an alliance with Vladimir I of Kiev
and organized the guard. New recruits from Sweden, Denmark, and Norway continued the Scandinavian predominance of the guard until the late eleventh century. So many Swedes left to enlist in the guard that a medieval Swedish law stated that no man could gain his inheritance while remaining in Greece. In The History of the Crusades author Steve Runciman noted that by the time of the Emperor Alexius, the Byzantine Varangian Guard was largely recruited from Anglo-Saxons in England and "others who had suffered at the hands" of the Vikings and the Normans.
There can also be other explanations for I1* Y-DNA's in Turkey. Tatar Turks are known to be over 18% I1* and this would be a reasonable explanation for the high I1* rates in Istanbul as many Crimean Tatars served the Ottoman Empire as administrators and military figures.
has given the following 'modal haplotype
s' within the I1 haplogroup according to examples found in I1 populations. Many I1-Norse types have been found to be downstream of the P109 SNP, concretely defining it as a haplogroup subclade and giving further credence to Nordtvedt's method of haplotyping. Furthermore, SNP L22 has been discovered to be upstream of P109, encompassing all of P109s Norse types, additional Norse types without P109 as well as Ultra Norse types excluded from the pool of P109 positives.
Such haplotyping is necessary because currently more resolution of potential subclades through matching STR alleles exists than is available via testing for known subclade SNPs in haplogroup I1.
I1 Anglo-Saxon (I1-AS) Has its peak gradient in the Germanic lowland countries: Germany
, Denmark
, and the Netherlands
I1 Norse (I1-N) Has its peak gradient in Sweden
.
I1 Ultra-Norse Type 1 (I1-uN1) Has its peak gradient in Iceland
and Norway
.
Many other Nordtvedt haplotypes exist, and Nordtvedt has continually refined the haplogroup with more types as they become apparent as more I1 types are tested.
, through genealogy and the testing of his descendants, has been placed within Y-DNA haplogroup I1.
The following are the technical specifications for known I1 haplogroup SNP and STR mutations.
Name: M253
Name: M307
Name: P30
Name: P40
Name: DYS455
gave the name of the Nordic deity Wodan to represent the clan patriarch of I1, as he did for mitochondrial haplogroups in a previous book, The Seven Daughters of Eve
. Every male identified as I1 is a descendant of this man.
Another writer, Stephen Oppenheimer
, discussed I1 in his book The Origins of the British. Although somewhat controversial, Oppenheimer, unlike Sykes, argued that Anglo-Saxons
did not have much impact on the genetic makeup of the British Isles. Instead he theorized that the vast majority of British ancestry originated in a paleolithic Iberian people, traced to modern-day Basque
populations, represented by the predominance of Haplogroup R1b in the United Kingdom
today. The book When Scotland Was Jewish is another example. These are direct challenges to previous studies led by Luigi Luca Cavalli-Sforza, Siiri Rootsi and others. Cavalli-Sforza has studied the connections between migration
patterns and blood groups. There has been some discussion of this on a mailing list at RootsWeb.
Spencer Wells
gave a brief description of I1 in the book Deep Ancestry: Inside The Genographic Project.
Human genetics
Human genetics describes the study of inheritance as it occurs in human beings. Human genetics encompasses a variety of overlapping fields including: classical genetics, cytogenetics, molecular genetics, biochemical genetics, genomics, population genetics, developmental genetics, clinical genetics,...
, Haplogroup I1 is a Y chromosome
Y chromosome
The Y chromosome is one of the two sex-determining chromosomes in most mammals, including humans. In mammals, it contains the gene SRY, which triggers testis development if present. The human Y chromosome is composed of about 60 million base pairs...
haplogroup
Haplogroup
In the study of molecular evolution, a haplogroup is a group of similar haplotypes that share a common ancestor having the same single nucleotide polymorphism mutation in both haplotypes. Because a haplogroup consists of similar haplotypes, this is what makes it possible to predict a haplogroup...
occurring at greatest frequency in Scandinavia, associated with the mutations identified as M253, M307, P30, and P40. These are known as single nucleotide polymorphisms (SNPs
Single nucleotide polymorphism
A single-nucleotide polymorphism is a DNA sequence variation occurring when a single nucleotide — A, T, C or G — in the genome differs between members of a biological species or paired chromosomes in an individual...
). It is a subclade
Subclade
In genetics, subclade is a term used to describe a subgroup of a subgenus or haplogroup. It is commonly used today in describing genealogical DNA tests of human mitochondrial DNA haplogroups and human Y-chromosome DNA haplogroups....
of Haplogroup I
Haplogroup I (Y-DNA)
In human genetics, Haplogroup I is a Y-chromosome DNA haplogroup, a subgroup of haplogroup IJ, itself a derivative of Haplogroup IJK....
. Before a reclassification in 2008, the group was known as Haplogroup I1a. Some individuals and organizations continue to use the I1a designation.
The group displays a very clear frequency gradient, with a peak of approximately 40 percent among the populations of western Finland
Finland
Finland , officially the Republic of Finland, is a Nordic country situated in the Fennoscandian region of Northern Europe. It is bordered by Sweden in the west, Norway in the north and Russia in the east, while Estonia lies to its south across the Gulf of Finland.Around 5.4 million people reside...
and more than 50 percent in the province of Satakunta, around 35 percent in southern Norway
Norway
Norway , officially the Kingdom of Norway, is a Nordic unitary constitutional monarchy whose territory comprises the western portion of the Scandinavian Peninsula, Jan Mayen, and the Arctic archipelago of Svalbard and Bouvet Island. Norway has a total area of and a population of about 4.9 million...
, southwestern Sweden
Sweden
Sweden , officially the Kingdom of Sweden , is a Nordic country on the Scandinavian Peninsula in Northern Europe. Sweden borders with Norway and Finland and is connected to Denmark by a bridge-tunnel across the Öresund....
especially on the island of Gotland
Gotland
Gotland is a county, province, municipality and diocese of Sweden; it is Sweden's largest island and the largest island in the Baltic Sea. At 3,140 square kilometers in area, the region makes up less than one percent of Sweden's total land area...
, Denmark
Denmark
Denmark is a Scandinavian country in Northern Europe. The countries of Denmark and Greenland, as well as the Faroe Islands, constitute the Kingdom of Denmark . It is the southernmost of the Nordic countries, southwest of Sweden and south of Norway, and bordered to the south by Germany. Denmark...
, and northern Germany
Northern Germany
- Geography :The key terrain features of North Germany are the marshes along the coastline of the North Sea and Baltic Sea, and the geest and heaths inland. Also prominent are the low hills of the Baltic Uplands, the ground moraines, end moraines, sandur, glacial valleys, bogs, and Luch...
, with rapidly decreasing frequencies toward the edges of the historically Germanic
Germanic peoples
The Germanic peoples are an Indo-European ethno-linguistic group of Northern European origin, identified by their use of the Indo-European Germanic languages which diversified out of Proto-Germanic during the Pre-Roman Iron Age.Originating about 1800 BCE from the Corded Ware Culture on the North...
sphere of influence.
Origins
For several years the prevailing theory was that during the Last Glacial MaximumLast Glacial Maximum
The Last Glacial Maximum refers to a period in the Earth's climate history when ice sheets were at their maximum extension, between 26,500 and 19,000–20,000 years ago, marking the peak of the last glacial period. During this time, vast ice sheets covered much of North America, northern Europe and...
(LGM) the predecessors of the I1 group sought refuge in the Balkans
Balkans
The Balkans is a geopolitical and cultural region of southeastern Europe...
. For a time, Ukraine was considered as an alternative. Yet, The Genographic Project
The Genographic Project
The Genographic Project, launched on April 13, 2005 by the National Geographic Society and IBM, is a multi-year genetic anthropology study that aims to map historical human migration patterns by collecting and analyzing DNA samples from hundreds of thousands of people from around the...
claims that the founder of the I1 branch lived on the Iberian Peninsula during the LGM. Some have given southern France and the Italian peninsula as possible sites as well. Although the locations vary, proponents of the refuge theories do seem to agree on one issue: that the I1 subclade
Subclade
In genetics, subclade is a term used to describe a subgroup of a subgenus or haplogroup. It is commonly used today in describing genealogical DNA tests of human mitochondrial DNA haplogroups and human Y-chromosome DNA haplogroups....
is from 15,000 to 20,000 years old.
Ken Nordtvedt
Ken Nordtvedt
Kenneth Leon Nordtvedt is a professor emeritus in the Physics Department at Montana State University and a senior researcher specializing in relativistic theories of gravity. He was born on April 16, 1939, in Chicago, Illinois. Nordtvedt graduated from the Massachusetts Institute of Technology and...
of Montana State University
Montana State University - Bozeman
Montana State University – Bozeman is a public university located in Bozeman, Montana. It is the state's land-grant university and primary campus in the Montana State University System, which is part of the Montana University System...
believes that I1 is a more recent group, probably emerging after the Last Glacial Maximum
Last Glacial Maximum
The Last Glacial Maximum refers to a period in the Earth's climate history when ice sheets were at their maximum extension, between 26,500 and 19,000–20,000 years ago, marking the peak of the last glacial period. During this time, vast ice sheets covered much of North America, northern Europe and...
LGM. Other researchers including Peter A. Underhill of the Human Population Genetics Laboratory at Stanford University
Stanford University
The Leland Stanford Junior University, commonly referred to as Stanford University or Stanford, is a private research university on an campus located near Palo Alto, California. It is situated in the northwestern Santa Clara Valley on the San Francisco Peninsula, approximately northwest of San...
have since supported this hypothesis in independent research.
The study of I1, which some had argued was largely ignored by the genetic testing industry in favor of "mega-haplogroups" like R, is in flux. Revisions and updates to previous thinking, primarily published in academic journals, is constant, yet slow, showing an evolution in thought and scientific evidence.
According to Nordtvedt, most recent common ancestor
Most recent common ancestor
In genetics, the most recent common ancestor of any set of organisms is the most recent individual from which all organisms in the group are directly descended...
(MRCA) of I1 lived from 4,000 to 6,000 years ago
Before Present
Before Present years is a time scale used in archaeology, geology, and other scientific disciplines to specify when events in the past occurred. Because the "present" time changes, standard practice is to use AD 1950 as the origin of the age scale, reflecting the fact that radiocarbon...
somewhere in the far northern part of Europe, perhaps Denmark
Denmark
Denmark is a Scandinavian country in Northern Europe. The countries of Denmark and Greenland, as well as the Faroe Islands, constitute the Kingdom of Denmark . It is the southernmost of the Nordic countries, southwest of Sweden and south of Norway, and bordered to the south by Germany. Denmark...
. His descendants are primarily found among the Germanic
Germanic peoples
The Germanic peoples are an Indo-European ethno-linguistic group of Northern European origin, identified by their use of the Indo-European Germanic languages which diversified out of Proto-Germanic during the Pre-Roman Iron Age.Originating about 1800 BCE from the Corded Ware Culture on the North...
populations of northern Europe and the bordering Uralic and Celtic populations, although even in traditionally German
Germans
The Germans are a Germanic ethnic group native to Central Europe. The English term Germans has referred to the German-speaking population of the Holy Roman Empire since the Late Middle Ages....
demographics I1 is overshadowed by the more prevalent Haplogroup R
Haplogroup R (Y-DNA)
In human genetics, haplogroup R is a Y-chromosome DNA haplogroup very common throughout Europe, Central Asia and South Asia, and also common in parts of the Middle East and Africa...
.
When SNPs are unknown or untested and when short tandem repeat
Short tandem repeat
A short tandem repeat in DNA occurs when a pattern of two or more nucleotides are repeated and the repeated sequences are directly adjacent to each other. The pattern can range in length from 2 to 5 base pairs and is typically in the non-coding intron region...
(STR) results show eight allele repeats at DYS455, haplogroup I1 can be predicted correctly with a very high rate of accuracy, 99.3 to 99.8 percent, according to Whit Athey and Vince Vizachero. This is almost exclusive to and ubiquitous in the I1 haplogroup, with very few having seven, nine, or another number. Furthermore, DYS462 divides I1 geographically. Nordtvedt considers 12 allele repeats to be more likely Anglo-Saxon and on the southern fringes of the I1 map, while 13 signifies more northerly, Nordic origins. Nordtvedt has repeatedly argued that, at least for I1, SNP testing is generally not as beneficial as expanded STR results.
Subclades
- I1 (M253, M307, L75, L80, L81, L118, L121, L123, L125, M450, M307.1/P203.1, P30, P40, S62, S63, S64, S65, S66, S107, S108, S109, S110, S111) formerly I1a
- I1*
- I1a (M21) formerly I1a2
- I1b (M227) formerly I1a1, I1a4
- I1b*
- I1b1 (M72) formerly I1a1a, I1a3
- I1c (P259) formerly I1d
- I1d (L22/S142)
- I1d*
- I1d1 (P109) formerly I1c
- I1e (S79)
- I1f (L338)
Distribution
Outside ScandinaviaScandinavia
Scandinavia is a cultural, historical and ethno-linguistic region in northern Europe that includes the three kingdoms of Denmark, Norway and Sweden, characterized by their common ethno-cultural heritage and language. Modern Norway and Sweden proper are situated on the Scandinavian Peninsula,...
, distribution of Haplogroup I1 is closely correlated with Haplogroup I2a1, but among Scandinavians including both Germanic and Uralic peoples of the region nearly all of the Haplogroup I
Haplogroup I (Y-DNA)
In human genetics, Haplogroup I is a Y-chromosome DNA haplogroup, a subgroup of haplogroup IJ, itself a derivative of Haplogroup IJK....
chromosomes are I1. It is common near the southern Baltic and North Sea coasts, although successively decreasing the further south geographically. The Migration Period
Migration Period
The Migration Period, also called the Barbarian Invasions , was a period of intensified human migration in Europe that occurred from c. 400 to 800 CE. This period marked the transition from Late Antiquity to the Early Middle Ages...
or "wandering of peoples" may explain the dispersion of I1 into areas beyond northern Europe.
Britain
Last Glacial Maximum
The Last Glacial Maximum refers to a period in the Earth's climate history when ice sheets were at their maximum extension, between 26,500 and 19,000–20,000 years ago, marking the peak of the last glacial period. During this time, vast ice sheets covered much of North America, northern Europe and...
the region was first repopulated by Paleolithic
Paleolithic
The Paleolithic Age, Era or Period, is a prehistoric period of human history distinguished by the development of the most primitive stone tools discovered , and covers roughly 99% of human technological prehistory...
hunter gatherers. During the Neolithic
Neolithic
The Neolithic Age, Era, or Period, or New Stone Age, was a period in the development of human technology, beginning about 9500 BC in some parts of the Middle East, and later in other parts of the world. It is traditionally considered as the last part of the Stone Age...
period, with the spread of farming, this population was supposedly replaced by the farmers. Later immigrations were thought to have accompanied the transitions to bronze and iron-working, known respectively as the Bronze
Bronze Age
The Bronze Age is a period characterized by the use of copper and its alloy bronze as the chief hard materials in the manufacture of some implements and weapons. Chronologically, it stands between the Stone Age and Iron Age...
and Iron Age
Iron Age
The Iron Age is the archaeological period generally occurring after the Bronze Age, marked by the prevalent use of iron. The early period of the age is characterized by the widespread use of iron or steel. The adoption of such material coincided with other changes in society, including differing...
s. The introduction of iron was particularly significant because archaeologists had associated it with the Hallstatt
Hallstatt culture
The Hallstatt culture was the predominant Central European culture from the 8th to 6th centuries BC , developing out of the Urnfield culture of the 12th century BC and followed in much of Central Europe by the La Tène culture.By the 6th century BC, the Hallstatt culture extended for some...
and La Tène culture
La Tène culture
The La Tène culture was a European Iron Age culture named after the archaeological site of La Tène on the north side of Lake Neuchâtel in Switzerland, where a rich cache of artifacts was discovered by Hansli Kopp in 1857....
s. These came to be associated by early archaeologists with the so-called Celtic culture, which was seemingly widespread on the continent. A later migration, that of the Anglo-Saxons
Anglo-Saxons
Anglo-Saxon is a term used by historians to designate the Germanic tribes who invaded and settled the south and east of Great Britain beginning in the early 5th century AD, and the period from their creation of the English nation to the Norman conquest. The Anglo-Saxon Era denotes the period of...
, was also claimed to have led to total population replacement, but genetic evidence suggests otherwise. In his Ecclesiastical History of the English People
Historia ecclesiastica gentis Anglorum
The Historia ecclesiastica gentis Anglorum is a work in Latin by Bede on the history of the Christian Churches in England, and of England generally; its main focus is on the conflict between Roman and Celtic Christianity.It is considered to be one of the most important original references on...
, Bede
Bede
Bede , also referred to as Saint Bede or the Venerable Bede , was a monk at the Northumbrian monastery of Saint Peter at Monkwearmouth, today part of Sunderland, England, and of its companion monastery, Saint Paul's, in modern Jarrow , both in the Kingdom of Northumbria...
claimed that the Angles
Angles
The Angles is a modern English term for a Germanic people who took their name from the ancestral cultural region of Angeln, a district located in Schleswig-Holstein, Germany...
came to Britain en masse as an entire nation leaving no one behind in their homeland Angeln
Angeln
Modern Angeln, also known as Anglia , is a small peninsula in Southern Schleswig in the northern Schleswig-Holstein, Germany, protruding into the Bay of Kiel...
. Other population movements (though not total displacements) recorded during historical times include those of the Danish and Norwegian Viking
Viking
The term Viking is customarily used to refer to the Norse explorers, warriors, merchants, and pirates who raided, traded, explored and settled in wide areas of Europe, Asia and the North Atlantic islands from the late 8th to the mid-11th century.These Norsemen used their famed longships to...
s, Danes in the east of England (especially the Danelaw
Danelaw
The Danelaw, as recorded in the Anglo-Saxon Chronicle , is a historical name given to the part of England in which the laws of the "Danes" held sway and dominated those of the Anglo-Saxons. It is contrasted with "West Saxon law" and "Mercian law". The term has been extended by modern historians to...
) and Norwegians in the Shetland and Orkney Isles, Western Isles and Ireland
Ireland
Ireland is an island to the northwest of continental Europe. It is the third-largest island in Europe and the twentieth-largest island on Earth...
.
The replacement model has been under sustained attack since the 1960s, with researchers asserting a much greater continuity than previously known or acknowledged. British archaeologist Simon James
Simon James (archaeologist)
Simon James, PhD is an archeologist of the Iron Age and Roman period and an author. He is Reader in Archaeology at the University of Leicester, England...
attributes the idea of large-scale mass migration to the assumption of primitivism about earlier inhabitants, assuming that cultural changes, such as nomadic hunter-gathering to farming, stone-working to metalworking, and bronze-working to iron-working, required newcomers introducing materials and techniques to the indigenous population, rather than them learning through trade or other methods.
Francis Pryor
Francis Pryor
thumb|180px|Francis Pryor discusses the excavation during the filming of a 2007 dig for [[Time Team]] with series editor Michael Douglas ....
has stated that he "can't see any evidence for bona fide mass migrations after the Neolithic
Neolithic
The Neolithic Age, Era, or Period, or New Stone Age, was a period in the development of human technology, beginning about 9500 BC in some parts of the Middle East, and later in other parts of the world. It is traditionally considered as the last part of the Stone Age...
." Historian Malcolm Todd
Malcolm Todd
Malcolm Todd FSA is a British historian and archaeologist with an interest in the interaction between the Roman Empire and Western Europe....
writes, "It is much more likely that a large proportion of the British population remained in place and was progressively dominated by a Germanic aristocracy, in some cases marrying into it and leaving Celtic names in the, admittedly very dubious, early lists of Anglo-Saxon dynasties. But how we identify the surviving Britons in areas of predominantly Anglo-Saxon settlement, either archaeologically or linguistically, is still one of the deepest problems of early English history." Although the idea of mass human migrations into Great Britain and Ireland is now a relatively minor point of view amongst British and Irish archaeologists, there is still a perception outside of the archaeological community that an "Anglo-Saxon" mass migration (especially) occurred, and that this forms a fundamental division between English "Anglo-Saxon" populations in Great Britain and non-English "Celtic" populations.
University College London
University College London is a public research university located in London, United Kingdom and the oldest and largest constituent college of the federal University of London...
in cooperation with Vrije Universiteit
Vrije Universiteit
The Vrije Universiteit is a university in Amsterdam, Netherlands. The Dutch name is often abbreviated as VU and in English the university uses the name "VU University". The university is located on a compact urban campus in the southern part of Amsterdam in the Buitenveldert district...
and the University of California, Davis
University of California, Davis
The University of California, Davis is a public teaching and research university established in 1905 and located in Davis, California, USA. Spanning over , the campus is the largest within the University of California system and third largest by enrollment...
claiming direct genetic evidence for population differences between the English and Welsh populations and proposed a model for mass invasion of eastern Great Britain from northern Germany
Northern Germany
- Geography :The key terrain features of North Germany are the marshes along the coastline of the North Sea and Baltic Sea, and the geest and heaths inland. Also prominent are the low hills of the Baltic Uplands, the ground moraines, end moraines, sandur, glacial valleys, bogs, and Luch...
and Denmark
Denmark
Denmark is a Scandinavian country in Northern Europe. The countries of Denmark and Greenland, as well as the Faroe Islands, constitute the Kingdom of Denmark . It is the southernmost of the Nordic countries, southwest of Sweden and south of Norway, and bordered to the south by Germany. Denmark...
. The authors assumed that populations with large proportions of haplogroup I originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea
North Sea
In the southwest, beyond the Straits of Dover, the North Sea becomes the English Channel connecting to the Atlantic Ocean. In the east, it connects to the Baltic Sea via the Skagerrak and Kattegat, narrow straits that separate Denmark from Norway and Sweden respectively...
with Anglo-Saxon migrations and Danish Vikings.
In her book Origins of the English Catherine Hills criticized these conclusions, arguing that a biased sampling strategy flawed the study, especially since testing was limited only to regions in England where Danes were known to have settled during the Danelaw, which is archaeologically distinct. In the paper the main claim by the researchers was
that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number … This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea … These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.
The paper was widely publicized in the media, especially in the United Kingdom, but reporting was often misleading and inaccurate. For example, the BBC
BBC
The British Broadcasting Corporation is a British public service broadcaster. Its headquarters is at Broadcasting House in the City of Westminster, London. It is the largest broadcaster in the world, with about 23,000 staff...
claimed that the "English and Welsh are races apart" and asserted "that between 50% and 100% of the indigenous population of what was to become England was wiped out" though this was not a claim of the paper. The conclusion for evidence of mass Anglo-Saxon migration, and that east English samples were more similar to Frisian samples than to Welsh samples, did not support the archaeological orthodoxy of modern times. A year later, in 2003, the paper "A Y Chromosome Census of the British Isles" was published by Capelli et al.. This paper, which sampled Great Britain and Ireland on a grid, found a much smaller difference between Welsh and English samples, and was much more characterised by isolation by distance, with a gradual decrease in Haplogroup I frequency moving westwards in southern Great Britain. It also found North German and Danish samples were not more similar to east English samples than Welsh samples.
Ice age
An ice age or, more precisely, glacial age, is a generic geological period of long-term reduction in the temperature of the Earth's surface and atmosphere, resulting in the presence or expansion of continental ice sheets, polar ice sheets and alpine glaciers...
. This suggests later waves of immigration may have been too small to have significantly affected the genetics of the pre-existing population.
Traditionally, areas with a majority Angle influence included the Kingdoms of Northumbria (Nord Angelnen, Nordimbria Anglorum), East Anglia
East Anglia
East Anglia is a traditional name for a region of eastern England, named after an ancient Anglo-Saxon kingdom, the Kingdom of the East Angles. The Angles took their name from their homeland Angeln, in northern Germany. East Anglia initially consisted of Norfolk and Suffolk, but upon the marriage of...
(Ost Angelnen) and Mercia
Mercia
Mercia was one of the kingdoms of the Anglo-Saxon Heptarchy. It was centred on the valley of the River Trent and its tributaries in the region now known as the English Midlands...
(Mittlere Angelnen) while the Saxon areas were the Kingdoms of Sussex
Kingdom of Sussex
The Kingdom of Sussex or Kingdom of the South Saxons was a Saxon colony and later independent kingdom of the Saxons, on the south coast of England. Its boundaries coincided in general with those of the earlier kingdom of the Regnenses and the later county of Sussex. A large part of its territory...
(Suth Seaxe), Essex
Kingdom of Essex
The Kingdom of Essex or Kingdom of the East Saxons was one of the seven traditional kingdoms of the so-called Anglo-Saxon Heptarchy. It was founded in the 6th century and covered the territory later occupied by the counties of Essex, Hertfordshire, Middlesex and Kent. Kings of Essex were...
(Est Seaxna), and Wessex
Wessex
The Kingdom of Wessex or Kingdom of the West Saxons was an Anglo-Saxon kingdom of the West Saxons, in South West England, from the 6th century, until the emergence of a united English state in the 10th century, under the Wessex dynasty. It was to be an earldom after Canute the Great's conquest...
(West Seaxna). The Kingdom of Kent
Kingdom of Kent
The Kingdom of Kent was a Jutish colony and later independent kingdom in what is now south east England. It was founded at an unknown date in the 5th century by Jutes, members of a Germanic people from continental Europe, some of whom settled in Britain after the withdrawal of the Romans...
was considered a place of another Germanic tribe, the Jutes
Jutes
The Jutes, Iuti, or Iutæ were a Germanic people who, according to Bede, were one of the three most powerful Germanic peoples of their time, the other two being the Saxons and the Angles...
. Stephen Oppenheimer
Stephen Oppenheimer
Stephen Oppenheimer is a British paediatrician, geneticist, and writer. He is a member of Green Templeton College, Oxford and an honorary fellow of Liverpool School of Tropical Medicine, and carries out and publishes research in the fields of genetics and human prehistory.-Career:Oppenheimer...
suggested that the Anglo-Saxon invasions actually had been predominantly Anglian.
Meanwhile, Bryan Sykes
Bryan Sykes
Bryan Sykes is a former Professor of Human Genetics at the University of Oxford and a current Fellow of Wolfson College.Sykes published the first report on retrieving DNA from ancient bone...
has said that the Anglo-Saxons made a substantial contribution to the genetic makeup of England, but probably less than 20 percent of the total, even in southern England, where raids and settlements were supposedly commonplace. His conclusions, on Britain at least, mirror those of other researchers including Siiri Rootsi and Nordtvedt. A report on the Saxons who were part of the Germanic settlement of Britain during and after the fifth century was issued by University College London
University College London
University College London is a public research university located in London, United Kingdom and the oldest and largest constituent college of the federal University of London...
in July 2006, with a wide-ranging estimate for the total number of settlers varying between 10,000 and 200,000.
The Vikings, both Danes and Norwegians, also made a substantial contribution after the Angles
Angles
The Angles is a modern English term for a Germanic people who took their name from the ancestral cultural region of Angeln, a district located in Schleswig-Holstein, Germany...
, Saxons
Saxons
The Saxons were a confederation of Germanic tribes originating on the North German plain. The Saxons earliest known area of settlement is Northern Albingia, an area approximately that of modern Holstein...
and Jutes
Jutes
The Jutes, Iuti, or Iutæ were a Germanic people who, according to Bede, were one of the three most powerful Germanic peoples of their time, the other two being the Saxons and the Angles...
, Sykes said, with concentrations in central, northern, and eastern England, territories of the ancient Danelaw
Danelaw
The Danelaw, as recorded in the Anglo-Saxon Chronicle , is a historical name given to the part of England in which the laws of the "Danes" held sway and dominated those of the Anglo-Saxons. It is contrasted with "West Saxon law" and "Mercian law". The term has been extended by modern historians to...
. Sykes said he found evidence of a very heavy Viking contribution in the Orkney and Shetland Islands, near 40 percent. Mitochondrial DNA as well as Y DNA of northern Germanic origin was discovered at substantial rates in all of these areas, showing that the Vikings engaged in large-scale settlement
History of Anglo-Saxon England
Anglo-Saxon England refers to the period of the history of that part of Britain, that became known as England, lasting from the end of Roman occupation and establishment of Anglo-Saxon kingdoms in the 5th century until the Norman conquest of England in 1066 by William the Conqueror...
, Sykes explained. However, Nordtvedt has said that separating I1 haplotypes into Viking and non-Viking groups has been impossible thus far.
Evidence of Norman
Normans
The Normans were the people who gave their name to Normandy, a region in northern France. They were descended from Norse Viking conquerors of the territory and the native population of Frankish and Gallo-Roman stock...
genetic influence in England was extremely small – about two percent according to Sykes, discounting the idea that William the Conqueror, his troops and any settlers disrupted and displaced previous cultures. Some notable British historians (and Anglophiles) assumed that the Norman invasion
Norman conquest of England
The Norman conquest of England began on 28 September 1066 with the invasion of England by William, Duke of Normandy. William became known as William the Conqueror after his victory at the Battle of Hastings on 14 October 1066, defeating King Harold II of England...
of AD 1066 greatly affected the society of the time and that little culture survived from the original Britons. In England, from the fifth to seventh centuries, the Anglo-Saxons soon developed their own paganism as well.
English language
English is a West Germanic language that arose in the Anglo-Saxon kingdoms of England and spread into what was to become south-east Scotland under the influence of the Anglian medieval kingdom of Northumbria...
began as a diverse group of dialects reflecting the varied backgrounds of the Anglo-Saxon kingdoms. One of these dialects, Late West Saxon, eventually dominated.
Then two waves of invaders brought new influences. The first was by language speakers of the Scandinavian branch, known as North Germanic. They conquered and colonized parts of Britain in the eighth and ninth centuries. The second was the Normans in the eleventh century, who spoke Old Norman
Old Norman
Old Norman, also called Old Northern French or Old Norman French, was one of many langues d'oïl dialects. It was spoken throughout the region of what is now called Normandy and spread into England, Southern Italy, Sicily, and the Levant. It is the ancestor of modern Norman, including the insular...
and ultimately developed an English variety called Anglo-Norman
Anglo-Norman language
Anglo-Norman is the name traditionally given to the kind of Old Norman used in England and to some extent elsewhere in the British Isles during the Anglo-Norman period....
. These two invasions caused English to become linguistically "mixed" to some degree. English developed into a "borrowing" language of great flexibility with a large vocabulary.
In England the Viking Age
Viking Age
Viking Age is the term for the period in European history, especially Northern European and Scandinavian history, spanning the late 8th to 11th centuries. Scandinavian Vikings explored Europe by its oceans and rivers through trade and warfare. The Vikings also reached Iceland, Greenland,...
began dramatically on June 8, 793, when Norsemen destroyed the abbey at Lindisfarne, plundering and murdering indiscriminately. An incident four years earlier, in which three Viking ships were beached in Portland Bay, perhaps on a trading expedition, created some tension, but Lindisfarne was different. The devastation of Northumbria's Holy Island shocked many, including the royal Courts of Europe. More than any other single event, the attack on Lindisfarne cast a shadow on the perception of the Vikings for the next twelve centuries.
France
Genetic remnants remain in northern France, indicating a small influx of I1 men, likely during Viking raids and subsequent settlement. Subtle increases in I1 haplotypes indicate a modest contribution, perhaps from a combination of the Frankish migration during the last days of the Roman Empire and later Viking incursions. Nordtvedt subscribes to this concept.The Franks
Franks
The Franks were a confederation of Germanic tribes first attested in the third century AD as living north and east of the Lower Rhine River. From the third to fifth centuries some Franks raided Roman territory while other Franks joined the Roman troops in Gaul. Only the Salian Franks formed a...
, for whom France
France
The French Republic , The French Republic , The French Republic , (commonly known as France , is a unitary semi-presidential republic in Western Europe with several overseas territories and islands located on other continents and in the Indian, Pacific, and Atlantic oceans. Metropolitan France...
(literally "Land of the Franks") is named, were a Germanic tribe first identified in the third century as an ethnic group living north and east of the Lower Rhine. They founded one of the Germanic monarchies which replaced the Western Roman Empire
Western Roman Empire
The Western Roman Empire was the western half of the Roman Empire after its division by Diocletian in 285; the other half of the Roman Empire was the Eastern Roman Empire, commonly referred to today as the Byzantine Empire....
from the fifth century. The Frankish state consolidated its hold over large parts of Western Europe by the end of the eighth century. The Carolingian Empire
Carolingian Empire
Carolingian Empire is a historiographical term which has been used to refer to the realm of the Franks under the Carolingian dynasty in the Early Middle Ages. This dynasty is seen as the founders of France and Germany, and its beginning date is based on the crowning of Charlemagne, or Charles the...
and its successor states were Frankish. French nobility were often descended from Frankish
Franks
The Franks were a confederation of Germanic tribes first attested in the third century AD as living north and east of the Lower Rhine River. From the third to fifth centuries some Franks raided Roman territory while other Franks joined the Roman troops in Gaul. Only the Salian Franks formed a...
and Norman
Normans
The Normans were the people who gave their name to Normandy, a region in northern France. They were descended from Norse Viking conquerors of the territory and the native population of Frankish and Gallo-Roman stock...
Germanic lineages and often bore Germanic names such as Charles de Gaulle
Charles de Gaulle
Charles André Joseph Marie de Gaulle was a French general and statesman who led the Free French Forces during World War II. He later founded the French Fifth Republic in 1958 and served as its first President from 1959 to 1969....
, though his family Y chromosome
Y chromosome
The Y chromosome is one of the two sex-determining chromosomes in most mammals, including humans. In mammals, it contains the gene SRY, which triggers testis development if present. The human Y chromosome is composed of about 60 million base pairs...
DNA
DNA
Deoxyribonucleic acid is a nucleic acid that contains the genetic instructions used in the development and functioning of all known living organisms . The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in...
has not been tested. The name “de Gaulle” likely came from “De Walle” which in German means “the wall" of a fortification or city.
Following the successful example of a Cornish-Viking alliance in 722 at the Battle of Hehil, which helped stop the Anglo-Saxon conquest of Cornwall
Cornwall
Cornwall is a unitary authority and ceremonial county of England, within the United Kingdom. It is bordered to the north and west by the Celtic Sea, to the south by the English Channel, and to the east by the county of Devon, over the River Tamar. Cornwall has a population of , and covers an area of...
at the time, the people of Brittany
Brittany
Brittany is a cultural and administrative region in the north-west of France. Previously a kingdom and then a duchy, Brittany was united to the Kingdom of France in 1532 as a province. Brittany has also been referred to as Less, Lesser or Little Britain...
(Bretons) made friendly overtures to the Danish Vikings in an effort to counter Frankish expansionism. In 866 the Vikings and Bretons united to defeat a Frankish army at the Battle of Brissarthe
Battle of Brissarthe
The Battle of Brissarthe was fought on 2 July 866), between the Franks and a joint Breton-Viking army near Brissarthe, Neustria. It was marked by the death of Robert the Strong, the Neustrian margrave, and Ranulf I, the duke of Aquitaine....
, resulting in formal recognition of Brittany's independence.
The Vikings continued to tactically help their Breton allies by devastating Frankish areas under the Carolingians with pillaging raids. In 885, one of the minor Viking leaders named Rollo
Rollo
Rollo has multiple meanings. It may mean:a first name*Rollo Armstrong, member of British dance act Faithless* Rollo May, American psychologist...
helped in the siege of Paris
Siege of Paris (885-886)
The Siege of Paris of 885 to 886 was a Viking siege of Paris, then capital of the kingdom of the West Franks. It was, in hindsight, the most important event of the reign of the Emperor Charles the Fat and a turning point in the fortunes of the Carolingian dynasty and the history of France.The...
under the command of Danish king Sigfred
Sigfred
Sigfred was possibly the second official king of Denmark whose reign started no later than the 770s and ended around 800. The precise dates remains unknown....
. When Sigfred retreated in return for tribute the following year, Rollo stayed behind and was eventually bought off and sent to bother Burgundy by the Frankish king, Charles the Simple
Charles the Simple
Charles III , called the Simple or the Straightforward , was the undisputed King of France from 898 until 922 and the King of Lotharingia from 911 until 919/23...
. Later, he returned to the Seine with a group of Danish followers who were called "Men of the North" or Norsemen
Norsemen
Norsemen is used to refer to the group of people as a whole who spoke what is now called the Old Norse language belonging to the North Germanic branch of Indo-European languages, especially Norwegian, Icelandic, Faroese, Swedish and Danish in their earlier forms.The meaning of Norseman was "people...
. They invaded the area of northern France now known as Normandy
Normandy
Normandy is a geographical region corresponding to the former Duchy of Normandy. It is in France.The continental territory covers 30,627 km² and forms the preponderant part of Normandy and roughly 5% of the territory of France. It is divided for administrative purposes into two régions:...
.
Rather than pay Rollo to leave, as was customary, Charles the Simple realized that his armies could not effectively defend against the raids and guerrilla tactics, and decided to appease Rollo by giving him land and hereditary titles under the condition that he defend against other Vikings. Led by Rollo, the Vikings settled in Normandy after being granted the land. They subsequently established the Duchy of Normandy
Duchy of Normandy
The Duchy of Normandy stems from various Danish, Norwegian, Hiberno-Norse, Orkney Viking and Anglo-Danish invasions of France in the 9th century...
. The descendants who emerged from the interactions of Vikings, Franks, and Gallo-Romans became known as Normans. This may explain why a noticeably higher than average rate of men living in northwestern France today are I1.
The Scandinavian colonisation of Normandy
Normandy
Normandy is a geographical region corresponding to the former Duchy of Normandy. It is in France.The continental territory covers 30,627 km² and forms the preponderant part of Normandy and roughly 5% of the territory of France. It is divided for administrative purposes into two régions:...
was principally Danish, complemented by a strong Norwegian contingent, although a few Swedes were present. The Viking colonization was not a mass phenomenon, but they established themselves rather densely in some areas, particularly Pays de Caux
Pays de Caux
The Pays de Caux is an area in Normandy occupying the greater part of the French département of Seine Maritime in Haute-Normandie. It is a chalk plateau to the north of the Seine Estuary and extending to the cliffs on the English Channel coast - its coastline is known as the Côte d'Albâtre...
and the northern part of the Cotentin. Toponymic and linguistic evidence supports this theory. The merging of the Scandinavian and native populations contributed to the creation of one of the most powerful feudal states of Western Europe. The naval ability of the Normans
Normans
The Normans were the people who gave their name to Normandy, a region in northern France. They were descended from Norse Viking conquerors of the territory and the native population of Frankish and Gallo-Roman stock...
would allow them to conquer England, and participate in the Crusades
Crusades
The Crusades were a series of religious wars, blessed by the Pope and the Catholic Church with the main goal of restoring Christian access to the holy places in and near Jerusalem...
.
Portugal
The presence of I1 is attested at 10% to 16% levels in areas of the N.W. Iberian peninsula in the countries of Portugal and also the Galician region of Spain. Their inland presence is harder to explain than the coastal areas, as well as the age, STR, etcRussia
From the ninth and into the tenth centuries, Scandinavian raiders and merchants travelled to Russia, Belarus and Ukraine, known as VarangiansVarangians
The Varangians or Varyags , sometimes referred to as Variagians, were people from the Baltic region, most often associated with Vikings, who from the 9th to 11th centuries ventured eastwards and southwards along the rivers of Eastern Europe, through what is now Russia, Belarus and Ukraine.According...
by the Byzantines. The Varangians have been described as a warrior elite or nobility.
Varangian leader Rurik
Rurik
Rurik, or Riurik , was a semilegendary 9th-century Varangian who founded the Rurik dynasty which ruled Kievan Rus and later some of its successor states, most notably the Tsardom of Russia, until 1598....
is credited with founding the first Rus state. Although recent genetic studies have identified two major lines within Rurikids, N1c1a
Haplogroup N (Y-DNA)
In human genetics, Haplogroup N is a Y-chromosome DNA haplogroup, defined by the presence of the marker M231. The b2/b3 deletion in the AZFc region of the human Y-chromosome is a characteristic of Haplogroup N haplotypes. This deletion, however, appears to have occurred independently on four...
and R1a, genetic research shows significant I1 contribution centering on Moscow
Moscow
Moscow is the capital, the most populous city, and the most populous federal subject of Russia. The city is a major political, economic, cultural, scientific, religious, financial, educational, and transportation centre of Russia and the continent...
.(dead link)
John Haywood, author of The Great Migrations, believes that a group known as the Rus
Rus' (people)
The Rus' were a group of Varangians . According to the Primary Chronicle of Rus, compiled in about 1113 AD, the Rus had relocated from the Baltic region , first to Northeastern Europe, creating an early polity which finally came under the leadership of Rurik...
preceded the Varangians. However, most identify the Rus people as a particular Varangian tribe. A large burial mound in Novgorod Oblast
Novgorod Oblast
Novgorod Oblast is a federal subject of Russia , located between Moscow and Saint Petersburg. Its administrative center is the city of Veliky Novgorod. Some of the oldest Russian cities, including Veliky Novgorod and Staraya Russa, are located there...
, Russia
Russia
Russia or , officially known as both Russia and the Russian Federation , is a country in northern Eurasia. It is a federal semi-presidential republic, comprising 83 federal subjects...
, known as a tumulus
Tumulus
A tumulus is a mound of earth and stones raised over a grave or graves. Tumuli are also known as barrows, burial mounds, Hügelgrab or kurgans, and can be found throughout much of the world. A tumulus composed largely or entirely of stones is usually referred to as a cairn...
and dating from the ninth century, is similar to those found in Old Uppsala, Sweden
Sweden
Sweden , officially the Kingdom of Sweden , is a Nordic country on the Scandinavian Peninsula in Northern Europe. Sweden borders with Norway and Finland and is connected to Denmark by a bridge-tunnel across the Öresund....
. It is reportedly well-defended against potential looters and has never been excavated. Local residents refer to it as 'Rurik's Grave'.
Scandinavians remained in control of areas such as Kiev
Kievan Rus'
Kievan Rus was a medieval polity in Eastern Europe, from the late 9th to the mid 13th century, when it disintegrated under the pressure of the Mongol invasion of 1237–1240....
until at least the mid-eleventh century. They became the nucleus of the Rus state, whose Golden Age in the eleventh and early twelfth centuries came to an abrupt end with the Mongol invasion of 1240.
Their campaigns are commemorated on many runestones in both Norway and Sweden, among them the Greece Runestones
Greece Runestones
The Greece runestones are about 30 runestones containing information related to voyages made by Norsemen to the Eastern Roman Empire. They were made during the Viking Age until about 1100 and were engraved in the Old Norse language with Scandinavian runes...
and the Varangian Runestones
Varangian Runestones
The Varangian Runestones are runestones that mention voyages to the East or the Eastern route , or to more specific eastern locations such as Garðaríki ....
. The last major expedition appears to have been the ill-fated expedition of Ingvar the Far-Travelled
Ingvar the Far-Travelled
Ingvar the Far-Travelled was the leader of an unsuccessful Viking attack against Persia, in 1036–1042.There were several Caspian expeditions of the Rus' in the course of the 10th century...
to Serkland
Serkland
In Old Norse sources, such as sagas and runestones, Særkland or Serkland was the name of the Abbasid Caliphate and probably some neighbouring Muslim regions....
, a region southeast of the Caspian Sea
Caspian Sea
The Caspian Sea is the largest enclosed body of water on Earth by area, variously classed as the world's largest lake or a full-fledged sea. The sea has a surface area of and a volume of...
, commemorated by the Ingvar Runestones
Ingvar Runestones
The Ingvar Runestones is the name of c. 26 Varangian Runestones that were raised in commemoration of those who died in the Swedish Viking expedition to the Caspian Sea of Ingvar the Far-Travelled....
. What happened to the men is not known.
Greece and Turkey
Another branch of Varangians dominated the Byzantine EmpireByzantine Empire
The Byzantine Empire was the Eastern Roman Empire during the periods of Late Antiquity and the Middle Ages, centred on the capital of Constantinople. Known simply as the Roman Empire or Romania to its inhabitants and neighbours, the Empire was the direct continuation of the Ancient Roman State...
military elite for a time. This could be the precursor of spikes in I1 haplotypes in Turkey and Greece near Istanbul
Istanbul
Istanbul , historically known as Byzantium and Constantinople , is the largest city of Turkey. Istanbul metropolitan province had 13.26 million people living in it as of December, 2010, which is 18% of Turkey's population and the 3rd largest metropolitan area in Europe after London and...
. A military unit known as the Varangian Guard was established by Emperor Basil II
Basil II
Basil II , known in his time as Basil the Porphyrogenitus and Basil the Young to distinguish him from his ancestor Basil I the Macedonian, was a Byzantine emperor from the Macedonian dynasty who reigned from 10 January 976 to 15 December 1025.The first part of his long reign was dominated...
. After Rus military recruits helped him quell a rebellion, Basil II formed an alliance with Vladimir I of Kiev
Vladimir I of Kiev
Vladimir Sviatoslavich the Great Old East Slavic: Володимѣръ Свѧтославичь Old Norse as Valdamarr Sveinaldsson, , Vladimir, , Volodymyr, was a grand prince of Kiev, ruler of Kievan Rus' in .Vladimir's father was the prince Sviatoslav of the Rurik dynasty...
and organized the guard. New recruits from Sweden, Denmark, and Norway continued the Scandinavian predominance of the guard until the late eleventh century. So many Swedes left to enlist in the guard that a medieval Swedish law stated that no man could gain his inheritance while remaining in Greece. In The History of the Crusades author Steve Runciman noted that by the time of the Emperor Alexius, the Byzantine Varangian Guard was largely recruited from Anglo-Saxons in England and "others who had suffered at the hands" of the Vikings and the Normans.
There can also be other explanations for I1* Y-DNA's in Turkey. Tatar Turks are known to be over 18% I1* and this would be a reasonable explanation for the high I1* rates in Istanbul as many Crimean Tatars served the Ottoman Empire as administrators and military figures.
Modal
Ken NordtvedtKen Nordtvedt
Kenneth Leon Nordtvedt is a professor emeritus in the Physics Department at Montana State University and a senior researcher specializing in relativistic theories of gravity. He was born on April 16, 1939, in Chicago, Illinois. Nordtvedt graduated from the Massachusetts Institute of Technology and...
has given the following 'modal haplotype
Modal haplotype
A modal haplotype is an ancestral haplotype derived from the DNA test results of a specific group of people, using genetic genealogy.The two most commonly discussed modal haplotypes are the Atlantic Modal Haplotype and the Cohen Modal Haplotype...
s' within the I1 haplogroup according to examples found in I1 populations. Many I1-Norse types have been found to be downstream of the P109 SNP, concretely defining it as a haplogroup subclade and giving further credence to Nordtvedt's method of haplotyping. Furthermore, SNP L22 has been discovered to be upstream of P109, encompassing all of P109s Norse types, additional Norse types without P109 as well as Ultra Norse types excluded from the pool of P109 positives.
Such haplotyping is necessary because currently more resolution of potential subclades through matching STR alleles exists than is available via testing for known subclade SNPs in haplogroup I1.
I1 Anglo-Saxon (I1-AS) Has its peak gradient in the Germanic lowland countries: Germany
Germany
Germany , officially the Federal Republic of Germany , is a federal parliamentary republic in Europe. The country consists of 16 states while the capital and largest city is Berlin. Germany covers an area of 357,021 km2 and has a largely temperate seasonal climate...
, Denmark
Denmark
Denmark is a Scandinavian country in Northern Europe. The countries of Denmark and Greenland, as well as the Faroe Islands, constitute the Kingdom of Denmark . It is the southernmost of the Nordic countries, southwest of Sweden and south of Norway, and bordered to the south by Germany. Denmark...
, and the Netherlands
Netherlands
The Netherlands is a constituent country of the Kingdom of the Netherlands, located mainly in North-West Europe and with several islands in the Caribbean. Mainland Netherlands borders the North Sea to the north and west, Belgium to the south, and Germany to the east, and shares maritime borders...
I1 Norse (I1-N) Has its peak gradient in Sweden
Sweden
Sweden , officially the Kingdom of Sweden , is a Nordic country on the Scandinavian Peninsula in Northern Europe. Sweden borders with Norway and Finland and is connected to Denmark by a bridge-tunnel across the Öresund....
.
I1 Ultra-Norse Type 1 (I1-uN1) Has its peak gradient in Iceland
Iceland
Iceland , described as the Republic of Iceland, is a Nordic and European island country in the North Atlantic Ocean, on the Mid-Atlantic Ridge. Iceland also refers to the main island of the country, which contains almost all the population and almost all the land area. The country has a population...
and Norway
Norway
Norway , officially the Kingdom of Norway, is a Nordic unitary constitutional monarchy whose territory comprises the western portion of the Scandinavian Peninsula, Jan Mayen, and the Arctic archipelago of Svalbard and Bouvet Island. Norway has a total area of and a population of about 4.9 million...
.
Many other Nordtvedt haplotypes exist, and Nordtvedt has continually refined the haplogroup with more types as they become apparent as more I1 types are tested.
Famous
Alexander HamiltonAlexander Hamilton
Alexander Hamilton was a Founding Father, soldier, economist, political philosopher, one of America's first constitutional lawyers and the first United States Secretary of the Treasury...
, through genealogy and the testing of his descendants, has been placed within Y-DNA haplogroup I1.
Mutations
Name: M253
- Type: SNP
- Source: M (Peter Underhill, Ph.D. of Stanford University)
- Position: ChrY:13532101..13532101 (+ strand)
- Position (base pair): 283
- Total size (base pairs): 400
- Length: 1
- ISOGG HG: I1
- Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG
- Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT
- YCC HG: I1
- Nucleotide alleles change (mutation): CCytosineCytosine is one of the four main bases found in DNA and RNA, along with adenine, guanine, and thymine . It is a pyrimidine derivative, with a heterocyclic aromatic ring and two substituents attached . The nucleoside of cytosine is cytidine...
to TThymineThymine is one of the four nucleobases in the nucleic acid of DNA that are represented by the letters G–C–A–T. The others are adenine, guanine, and cytosine. Thymine is also known as 5-methyluracil, a pyrimidine nucleobase. As the name suggests, thymine may be derived by methylation of uracil at...
Name: M307
- Type: SNP
- Source: M (Peter Underhill, Ph.D. of Stanford UniversityStanford UniversityThe Leland Stanford Junior University, commonly referred to as Stanford University or Stanford, is a private research university on an campus located near Palo Alto, California. It is situated in the northwestern Santa Clara Valley on the San Francisco Peninsula, approximately northwest of San...
) - Position: ChrY:21160339..21160339 (+ strand)
- Length: 1
- ISOGG HG: I1
- Primer F: TTATTGGCATTTCAGGAAGTG
- Primer R: GGGTGAGGCAGGAAAATAGC
- YCC HG: I1
- Nucleotide alleles change (mutation): GGuanineGuanine is one of the four main nucleobases found in the nucleic acids DNA and RNA, the others being adenine, cytosine, and thymine . In DNA, guanine is paired with cytosine. With the formula C5H5N5O, guanine is a derivative of purine, consisting of a fused pyrimidine-imidazole ring system with...
to AAdenineAdenine is a nucleobase with a variety of roles in biochemistry including cellular respiration, in the form of both the energy-rich adenosine triphosphate and the cofactors nicotinamide adenine dinucleotide and flavin adenine dinucleotide , and protein synthesis, as a chemical component of DNA...
Name: P30
- Type: SNP
- Source: PS (Michael Hammer, Ph.D. of the University of Arizona and James F. Wilson, D.Phil. at the University of Edinburgh)
- Position: ChrY:13006761..13006761 (+ strand)
- Length: 1
- ISOGG HG: I1
- Primer F: GGTGGGCTGTTTGAAAAAGA
- Primer R: AGCCAAATACCAGTCGTCAC
- YCC HG: I1
- Nucleotide alleles change (mutation): G to A
- Region: ARSDP
Name: P40
- Type: SNP
- Source: PS (Michael Hammer, Ph.D. of the University of ArizonaUniversity of ArizonaThe University of Arizona is a land-grant and space-grant public institution of higher education and research located in Tucson, Arizona, United States. The University of Arizona was the first university in the state of Arizona, founded in 1885...
and James F. Wilson, D.Phil. at the University of EdinburghUniversity of EdinburghThe University of Edinburgh, founded in 1583, is a public research university located in Edinburgh, the capital of Scotland, and a UNESCO World Heritage Site. The university is deeply embedded in the fabric of the city, with many of the buildings in the historic Old Town belonging to the university...
) - Position: ChrY:12994402..12994402 (+ strand)
- Length: 1
- ISOGG HG: I1
- Primer F: GGAGAAAAGGTGAGAAACC
- Primer R: GGACAAGGGGCAGATT
- YCC HG: I1
- Nucleotide alleles change (mutation): C to T
- Region: ARSDP
Name: DYS455
- Type: STR (repeat)
- Position: ChrY:6971459..6971638 (+ strand)
- Length: 180
- Primer F: ATCTGAGCCGAGAGAATGATA
- Primer R: GGGGTGGAAACGAGTGTT
Popular culture
In the book Blood of the Isles, published in North America as Saxons, Vikings & Celts: The Genetic Roots of Britain and Ireland, author Bryan SykesBryan Sykes
Bryan Sykes is a former Professor of Human Genetics at the University of Oxford and a current Fellow of Wolfson College.Sykes published the first report on retrieving DNA from ancient bone...
gave the name of the Nordic deity Wodan to represent the clan patriarch of I1, as he did for mitochondrial haplogroups in a previous book, The Seven Daughters of Eve
The Seven Daughters of Eve
The Seven Daughters of Eve is a book by Bryan Sykes that presents the theory of human mitochondrial genetics to a general audience...
. Every male identified as I1 is a descendant of this man.
Another writer, Stephen Oppenheimer
Stephen Oppenheimer
Stephen Oppenheimer is a British paediatrician, geneticist, and writer. He is a member of Green Templeton College, Oxford and an honorary fellow of Liverpool School of Tropical Medicine, and carries out and publishes research in the fields of genetics and human prehistory.-Career:Oppenheimer...
, discussed I1 in his book The Origins of the British. Although somewhat controversial, Oppenheimer, unlike Sykes, argued that Anglo-Saxons
Anglo-Saxons
Anglo-Saxon is a term used by historians to designate the Germanic tribes who invaded and settled the south and east of Great Britain beginning in the early 5th century AD, and the period from their creation of the English nation to the Norman conquest. The Anglo-Saxon Era denotes the period of...
did not have much impact on the genetic makeup of the British Isles. Instead he theorized that the vast majority of British ancestry originated in a paleolithic Iberian people, traced to modern-day Basque
Basque people
The Basques as an ethnic group, primarily inhabit an area traditionally known as the Basque Country , a region that is located around the western end of the Pyrenees on the coast of the Bay of Biscay and straddles parts of north-central Spain and south-western France.The Basques are known in the...
populations, represented by the predominance of Haplogroup R1b in the United Kingdom
United Kingdom
The United Kingdom of Great Britain and Northern IrelandIn the United Kingdom and Dependencies, other languages have been officially recognised as legitimate autochthonous languages under the European Charter for Regional or Minority Languages...
today. The book When Scotland Was Jewish is another example. These are direct challenges to previous studies led by Luigi Luca Cavalli-Sforza, Siiri Rootsi and others. Cavalli-Sforza has studied the connections between migration
Human migration
Human migration is physical movement by humans from one area to another, sometimes over long distances or in large groups. Historically this movement was nomadic, often causing significant conflict with the indigenous population and their displacement or cultural assimilation. Only a few nomadic...
patterns and blood groups. There has been some discussion of this on a mailing list at RootsWeb.
Spencer Wells
Spencer Wells
Spencer Wells is a geneticist and anthropologist, an at the National Geographic Society, and Frank H.T. Rhodes Class of '56 Professor at Cornell University. He leads The Genographic Project.-Education:...
gave a brief description of I1 in the book Deep Ancestry: Inside The Genographic Project.
Further reading
- Y-chromosome diversity in Sweden – A long-time perspective
- Y chromosome evidence for Anglo-Saxon mass migration
- A Y Chromosome Census of the British Isles
- Resolving the Placement of Haplogroup I-M223 in the Y-Chromosome Phylogenetic Tree
- Human Y-Chromosomal Variation in European Populations
- Oppenheimer, Stephen The Origins of the British: A Genetic Detective Story (Carroll & Graf, 2006) ISBN 978-0786718900
- Sykes, Bryan Saxons, Vikings, and Celts: The Genetic Roots of Britain and Ireland (W. W. Norton, 2006) ISBN 978-0393062687
See also
- HaplogroupHaplogroupIn the study of molecular evolution, a haplogroup is a group of similar haplotypes that share a common ancestor having the same single nucleotide polymorphism mutation in both haplotypes. Because a haplogroup consists of similar haplotypes, this is what makes it possible to predict a haplogroup...
- Human Y-chromosome DNA haplogroupsHuman Y-chromosome DNA haplogroupsIn human genetics, a Human Y-chromosome DNA haplogroup is a haplogroup defined by differences in the non-recombining portions of DNA from the Y chromosome ....
- Haplogroup I (Y-DNA)Haplogroup I (Y-DNA)In human genetics, Haplogroup I is a Y-chromosome DNA haplogroup, a subgroup of haplogroup IJ, itself a derivative of Haplogroup IJK....
- Haplogroup I2 (Y-DNA)Haplogroup I2 (Y-DNA)In human genetics, Haplogroup I2 is a Y-chromosome haplogroup. Until 2008, it was known as Haplogroup I1b. Haplogroup I2 might have originated in Southeastern Europe some 15,000 - 17,000 years ago and developed into three main subgroups : I2*, I2a, and I2b.-Subclades:Note: The systematic subclade...
- Genetic history of EuropeGenetic history of EuropeThe genetic history of Europe can be inferred from the patterns of genetic diversity across continents and time. The primary data to develop historical scenarios coming from sequences of mitochondrial, Y-chromosome and autosomal DNA from modern populations and if available from ancient DNA...
- European ethnic groupsEuropean ethnic groupsThe ethnic groups in Europe are the various ethnic groups that reside in the nations of Europe. European ethnology is the field of anthropology focusing on Europe....
- Late Glacial Maximum
- Neolithic EuropeNeolithic EuropeNeolithic Europe refers to a prehistoric period in which Neolithic technology was present in Europe. This corresponds roughly to a time between 7000 BC and c. 1700 BC...
- Germanic peoplesGermanic peoplesThe Germanic peoples are an Indo-European ethno-linguistic group of Northern European origin, identified by their use of the Indo-European Germanic languages which diversified out of Proto-Germanic during the Pre-Roman Iron Age.Originating about 1800 BCE from the Corded Ware Culture on the North...
- Norse SagasSagaSagas, are stories in Old Norse about ancient Scandinavian and Germanic history, etc.Saga may also refer to:Business*Saga DAB radio, a British radio station*Saga Airlines, a Turkish airline*Saga Falabella, a department store chain in Peru...
- History of NormandyHistory of NormandyNormandy was a province in the North-West of France under the Ancien Régime. Initially populated by Celtic tribes in the West and Belgian tribes in the North East, it was conquered in 98 AD by the Romans and integrated into the province of Gallia Lugdunensis by Augustus. In the 4th century, Gratian...
- Norse colonization of the AmericasNorse colonization of the AmericasThe Norse colonization of the Americas began as early as the 10th century, when Norse sailors explored and settled areas of the North Atlantic, including the northeastern fringes of North America....
External links
- Haplogroup I Subclade Predictor
- I HG Y-chromosome research by Ken Nordtvedt
- Nordvedt's Haplogroup I Clusters with STR Markers in FTDNA Order
- Danish Demes Regional DNA Project: Y-DNA Haplogroup I1 (I-M253) Results
- Danish Demes Regional DNA Project: Y-DNA Haplogroups I1d (I-L22) and I1d1 (I-P109) Results
- Testing for the S-series of SNPs within Haplogroup I1 (Called I1a)
- Distribution of Repeat Values at Various STR Sites for Haplogroup I1 (Called I1a)
- Haplogrou I1 discussion forum at FTDNA (requires membership to view threads)
- Haplogroup I1 DYS frequencies according to Geographical Locale (Called I1a)
- Dienekes Anthropology page; I1 as modal haplotype of Western Norway (Called I1a)
- Mailing List for Y-DNA Haplogroup I
- Haplogroup I and Its Subclades
