Haplogroup G2a3b1 (Y-DNA)
Encyclopedia
In human genetics
, Haplogroup G2a3b1 (P303) is a Y-chromosome haplogroup
. It is a branch of haplogroup G (Y-DNA)
(M201). In descending order, G2a3b1 is additionally a branch of G2 (P287), G2a (P15), G2a3 (L30 or S126) and finally G2a3b (L141). This haplogroup represents the majority of haplogroup G men in most areas of Europe
west of Russia
and the Black Sea
. To the east, G2a3b1-except in the Caucasus Mountains
area-is just a large or small minority among G persons in such locales as Turkey
, the Middle East
, Iran
, the southern Caucasus area, China
and India
.
(STR) findings among G2a3b1 men which help in subgrouping them. Many of the men have an unusual value of 13 for marker DYS388, and some have 9 at DYS568. STR marker oddities are often different in each G2a3b1 subgroup, and characteristic marker values can vary by subgroup. Often the values of STR markers DYS391, DYS392 and DYS393, however, are respectively 10, 11 and 14 or some slight variation on these for all G2a3b1 men.
P303 first became available for public testing in fall 2008, and the P designation indicates it was identified at the University of Arizona
. The mutation is found on the Y chromosome at position 20104736. The forward primer is TTCTTATTTGCTTTGAAACTCAG. The reverse primer is ATTGGCTTATCAGATTGACG. The mutation involves replacement of T by C. This mutation was actually first identified as S135 at Ethnoancestry in London, England, but it took some time to realize that P303, which was independently identified, and S135 were the same.
to samples from more easterly locales. Several subgroups may have originated within Europe.
G2a3b1 definable subgroups are heavily concentrated in Europe west of Russia
and the Black Sea
, but small numbers are also found in a geographical belt extending from northern Africa to northeastern Asia
.
In Europe, the Baltic countries
have the lowest population percentage of G2a3b1. Scandinavia
is similar, showing half the percentages of G persons seen in the countries to the south.
G2a3b1 seems to represent the same percentage of the population in both central and southern Europe and usually represents half or more of the G seen in the population in these areas.
Isolated G2a3b1 samples are found also in North Africa (Tunisia
, Libya
and Egypt
), in the Middle East
(Saudi Arabia
and Dubai
), the Caucasus Mountains
area (Armenia
, Georgia
, Azerbaijan
, N. Ossetia
in Russia, among Russian Kabardinians, Abazinia
in Georgia), in Iran
, in Uzbekistan
and among the ethnic groups of northwesternChina
and Russian Siberia
. A distinctive Indian type of G2a3b1 exists, but its prevalence is unclear. And an isolated G2a3b1 sample from Malaysia exists.
has about the same percentage of haplogroup G as some lower altitude European countries. Sardinia
has a significant amount of a unique type of haplogroup G based on STR marker values, and the percentage of G in the highlands is not unusually higher than for example, in the northern coastal area. There is no noticeable concentration of haplogroup G (and G2a3b1) in the high Alpine areas of Italy
which has a varied landscape. In addition, the high mountainous region east of the Black Sea
where concentrated pockets of haplogroup G are found contains only tiny amounts of the types of haplogroup G found in Europe proper. Austria
is the one European exception where haplogroup G seems more common in the western highest mountains than elsewhere, but much of Austria is mountainous
off the eastern Spanish coast. All of the available haplogroup G samples from there are typical G2a3b1 samples based on STR marker values. In total, about 16% of the population is likely G2a3b1 on the same basis.
Ibiza samples include identifiable persons from the DYS388=13 subgroup. Because value combinations of the STR marker samples in Ibiza are also common in Sephardic Jewish samples, the haplogroup G in Ibiza might be related to the significant population of Crypto-Jews in Ibiza.
The percentage of haplogroup G among available samples from Wales
is overwhelmingly G2a3b1. Such a high percentage is not found in nearby England
, Scotland
or Ireland
.
, and one each from Spain
, Bulgaria
and Iran
have been identified as belonging to this category.
A high percentage of all tested European U1+ persons so far are positive for the subgroup in which the L13 or S13 SNP mutation is present. Preliminary indications are that U1+/L13- persons may be common in the northern Caucasus region and some samples have been found in Armenia as well.
U1 was first identified at the University of Central Florida
in 2006 but it was not described in a publication until 2009. The listed technical specifications are:....location rs9785956.....forward primer is TTTCTGCTCCAAATCTGCTG....reverse primer is CACCTGTAATCGGGAGGCTA....the mutation involves a change from A to G.
This second most populous G2a3b1 subgroup is characterized by the presence of the L13/S13 SNP. Almost all L13+ persons of European ancestry have the value of 12 or 13 at STR marker DYS385a and values of 19,20 at STR marker YCA. There are a few L13+ samples available which lack these mutations, and a shared common ancestor farther back in time from the others can be presumed for these samples.
The L13/S13 SNP was first identified at the University of Central Florida
in 2006 as the U13 SNP, but prior to the publication of the details of this research in 2009, the SNP was also independently identified in 2008 at Family Tree DNA in Houston, Texas, as L13 and at Ethnoancestry in England as S13 and made available for public testing. The technical specifications are given as.....Y chromosome location rs9786706.....forward primer is GTGGTAACAGCTCCTGGTGAG.....reverse primer is TGCTGCTTTGGTTAACTGTCC...the mutation involves a change from C to T.
The G2a3b1a1a subgroup is most common in north central Europe and is found in almost all places in Europe where other types of G are seen, but this subgroup seems rare in almost all countries outside Europe. Some atypical marker values seen outside Europe make L13+ persons hard to identify based on marker values, and the L13+ status may be more common in such places as the Caucasus Mountain region than presently suggested. The Haplogroup G Project has also collected samples from the Middle East, Iran and Caucasus Mountain region with mutated marker values similar to the European G2a3b1a1 men, especially at STR markers DYS385 and YCA. But the similarities could be only coincidental due to lack of SNP testing.
The common ancestor of almost all European L13+ men seems to have lived at least 2,500 years ago based on comparative 67-marker STR samples, and the mutation itself may be about 3,000 years old based on the same data.
The Haplogroup G Project has indicated among its large G collection that likely or proven G2a3b1a1 STR samples comprise the following percentages of available G samples in the following European countries [in descending order]:
Germany, 16%.....Italy, 11%.....Netherlands, 10%.....France, 10%.....Poland, 9%.....Spain, 9%.....Ireland, 6%.....England, 5%.....Switzerland, 4%
and made available for separate testing at L497 by Family Tree DNA. The chromosome locations are given as 15932714 and rs35141399, and the mutation is from C to T. The forward primer is ATGAGTGGCCTCACCAAGGGAATC and reverse primer is ATGGGCAACAGGTGTCCTGAAG.
A high percentage of men with L497 have the value of 13 at STR marker DYS388. This is a rare mutation from the ancestral value of 12. A very small number of men within this DYS388=13 subgroup seem to have mutated yet again to 12 or 14. The geographical distribution of this 13 mutation and other features were first described in a research journal in 2007. Percentages of DYS388=13 men within G samples are particularly high in northwestern Europe. Some DYS388=13 subgroups below are based on SNP mutations and others on STR marker value oddities.
The Haplogroup G Project has indicated among its large G collection that likely or proven STR samples from the DYS388=13 type of G2a3b1a comprise the following percentages of available G samples in the following countries [in descending order]:
Switzerland, 74%.....Spain, 60%.....France, 58%....Germany, 57%.....England, 54%....Ireland, 48%.....Netherlands, 45%.....Italy, 43%....Poland, 29%....India, 0%
The Polish percentage of DYS388=13 men is diminished solely because of the origins of a significant group of G2c men in that country. Without the G2c group, the DYS388=13 percentage is 50%. The German G samples are much more numerous in the southwestern part of the country.
While DYS388=13 G persons are found in Iran, so far all such samples have been found not at all related to the DYS388=13 persons of Europe. Apparently the mutation to 13 occurred independently in other G categories in that country. The only non-European DYS388=13 sample that has surfaced from the Old World
that has similar STR marker values to the Europeans is a single sample from Egypt.
The age of the mutation of DYS388 to 13 seems at least 2,500 yrs old based on comparison of 67-marker STR samples. The paucity of proven samples from outside Europe so far leaves open the possibility this DYS388 mutation originated in a European.
This G2a3b1a2a subgroup is rare because virtually all tested L43+/S147+ persons so far are also L42+/S146+.
The SNP that characterizes G2a3b1a2a was first identified in a listing of SNP results from testing at 23andMe
. It was independently developed as a separate test by both Family Tree DNA as L43 and by Ethnoancestry as S147. In fall 2009 a test again at 23andMe provided information for the first time that a person who had the L43 mutation simultaneously lacked the L42 mutation that typically occurs with L43. This anomaly was verified by testing the same person at Family Tree DNA. So L43+/S147+ is now a separate category. The technical specifications for L43 are as follows: Y chromosome location 16446759....forward primer is GAGGTTTTCGGAGCTTACCTATAC....reverse primer is CACTGCTTGTAGATAGTAAAGTTTG.....the mutation involves change from A to G.
About a fourth of DYS388=13 men have this L42/S146 mutation. Swiss G2a3b1a men are more likely than average to belong to this subgroup. L42/S146 could be nearly as old as the DYS388=13 mutation (over 2,500 yrs.) based on the number of value differences seen in 67-marker STR samples.
The SNP that characterizes G2a3b1a2a was first identified in a listing of SNP results from testing at 23andMe
. It was independently developed as a separate test by both Family Tree DNA as L42 and by Ethnoancestry as S146. The technical specifications for this SNP are as follows:....position on Y chromosome is 15170153.....forward primer is CTCACAATAGGCAGCATCCCCTCAG.....reverse primer is CAGAAAAAGGGAGCATATGACCAAGG.....the mutation involves a change from C to A.
This mutation was found in a raw data file of a man with an English/Scottish surname at 23andMe in summer 2010. The mutation is from C to T. Another designation for the chromosome location is 15862538. This mutation so far is found only in a single person, and four other G2a3b1a2a men tested negative (ancestral) for this mutation. It is yet to be determined if this SNP is found only in the family of the positive man or has more general coverage. It is to be noted that the man with this mutation has a large loss of repeats at STR marker DYS413a. There is at least one other man genetically near to him with the same DYS413a oddity. Whichever mutation is eventually determined to be more recent will become a subgroup of the other.
This mutation was identified at Family Tree DNA in summer 2010. The mutation is from G to T. The chromosome location is 15170096. This mutation so far is found only in a single person, and seven other G2a3b1a2a men tested negative (ancestral) for this mutation. It is yet to be determined if this SNP is found only in the family of the positive man or has more general coverage.
The L139 SNP was found so far only in one DYS388=13 man, and it is uncertain if this SNP is only familial or has slightly broader coverage. For sure, L139 is not common because multiple other DYS388=13 men have tested negative for L139. The L139+ man is known negative (ancestral) for the L43 and L42 SNPs.
SNP L139 was first identified at Family Tree DNA in Houston, Texas, in mid-2009 and made available for testing at that time. The technical specifications for L139 are as follows:.....located at 13981304 on Y-chromosome.....the mutation involves change from G to A.
The rs2538860 region of the Y-chromosome with a finding of A+ was determined in one DYS388=13 man during testing at 23andMe
, and it is uncertain if this SNP is only familial or has slightly broader coverage. For sure, this mutation is not common since multiple other DYS388=13 men who have tested negative for this. The man with the mutation is known negative (ancestral) for the L43 and L42 SNPs. None of the commercial labs have yet provided a shortened name, such as L139, for this mutation.
The mutation at rs2538860 was first identified in a raw data file at 23andMe, in June 2010. The technical specifications are as follows:.....located at 10342008 on Y-chromosome.....the mutation involves change from C to A.
This multi-value (multistep) mutation at STR marker DYS391 to the value of 7 from the original 10 is found in a group of Hispanic
men. No information is available about their L42 and L43 status.
This multi-value (multistep) mutation at STR marker DYS464a to the value of 9 is found so far only in Swiss and German men. No information is available about their L42 and L43 status.
This small subgroup is composed of men whose ancestor mutated two values at STR marker DYS388 to 15. Members of this subgroup must have other marker values similar to persons in the overall DYS388=13 subgroup. So far only persons of English ancestry belong to this DYS388=15 subgroup. Marker DYS388 rarely mutates, and a two-step (two-value) mutation is almost as valuable as a SNP mutation in identifying persons within this distinctive subgroup.
This small subgroup is composed of men whose ancestor mutated at STR marker DYS393 to 12. This marker value is unusually low for G persons. The persons with this finding seem to report ancestral origins primarily in Cyprus
based on current knowledge.
While a mutation to a value of 12 from 10 or 11 is seen primarily in this group, there exist a few DYS594=12 men who do not belong to the group. The men in this group form a distinctive cluster of persons with closely related STR marker values in addition to the DYS594 oddity. This DYS594=12 subgroup has an unusually high percentage of Welsh surnames with the rest mostly of English ancestry based on available samples. Multiple persons in this group have tested negative for the L43 and L42 SNP mutations.
No DYS568=9 persons have been located in the Middle East or Anatolia region where haplogroup G can be unusually common. Several samples, however, have been found among Ossetians in the central Caucasus Mountains. Though found all over Europe, DYS568=9 is so far missing from Scandinavian samples north of Denmark.
This DYS568=9 subgroup contains a further large subgroup consisting of Ashkenazi Jews who are relatively closely related based on STR marker values and typically have a value of 16 for marker DYS385b. The Jewish cluster does not seem to share a common ancestor with the non-Jewish men within the Current Era. And the common ancestor of the Ashkenazi DYS568=9 men likely lived in the Middle Ages based on the small number of STR marker value difference seen among them. See also page covering Jews with Haplogroup G (Y-DNA)
.
There is another, smaller subgroup of DYS568=9 persons who have the value of 9 at STR marker DYS439. The ancestral value for this marker is 12 within the DYS568=9 group, and this 9 represents a rare multi-step mutation. This DYS439=9 subgroup is predominantly German, and the mutation is probably over 2,000 years old based on number of marker value differences in 67-marker STR samples.
The Haplogroup G Project has indicated among its large G collection that likely or proven DYS568=9 samples comprise the following percentages of available G samples in the following countries [in descending order]:
Ireland, 12%.....England, 9%.....Netherlands, 5%.....Poland, 5%.....Italy, 4%.....Germany, 3%.....Spain, 3%.....France, 2%.....Switzerland, 0%
Within the DYS568=9 subgroup -- which lacks its own SNP -- is subgroup G2a3b1a3 (L640+). This is a small group of men presently all from the British Isles. This SNP was identified in summer 2011 at Family Tree DNA. It represents a mutation from A to G and is found at position 16903082 on the Y chromosome. Most, if not all, these L640+ men also have the value of 8 at marker DY533 which is otherwise rare among DYS568=9 men.
a change from C to A. L662 is found at position 16446702 and is a change from C to T.
Human genetics
Human genetics describes the study of inheritance as it occurs in human beings. Human genetics encompasses a variety of overlapping fields including: classical genetics, cytogenetics, molecular genetics, biochemical genetics, genomics, population genetics, developmental genetics, clinical genetics,...
, Haplogroup G2a3b1 (P303) is a Y-chromosome haplogroup
Haplogroup
In the study of molecular evolution, a haplogroup is a group of similar haplotypes that share a common ancestor having the same single nucleotide polymorphism mutation in both haplotypes. Because a haplogroup consists of similar haplotypes, this is what makes it possible to predict a haplogroup...
. It is a branch of haplogroup G (Y-DNA)
Haplogroup G (Y-DNA)
In human genetics, Haplogroup G is a Y-chromosome haplogroup. It is a branch of Haplogroup F . Haplogroup G has an overall low frequency in most populations but is widely distributed within many ethnic groups of the Old World in Europe, northern and western Asia, northern Africa, the Middle East,...
(M201). In descending order, G2a3b1 is additionally a branch of G2 (P287), G2a (P15), G2a3 (L30 or S126) and finally G2a3b (L141). This haplogroup represents the majority of haplogroup G men in most areas of Europe
Europe
Europe is, by convention, one of the world's seven continents. Comprising the westernmost peninsula of Eurasia, Europe is generally 'divided' from Asia to its east by the watershed divides of the Ural and Caucasus Mountains, the Ural River, the Caspian and Black Seas, and the waterways connecting...
west of Russia
Russia
Russia or , officially known as both Russia and the Russian Federation , is a country in northern Eurasia. It is a federal semi-presidential republic, comprising 83 federal subjects...
and the Black Sea
Black Sea
The Black Sea is bounded by Europe, Anatolia and the Caucasus and is ultimately connected to the Atlantic Ocean via the Mediterranean and the Aegean seas and various straits. The Bosphorus strait connects it to the Sea of Marmara, and the strait of the Dardanelles connects that sea to the Aegean...
. To the east, G2a3b1-except in the Caucasus Mountains
Caucasus Mountains
The Caucasus Mountains is a mountain system in Eurasia between the Black Sea and the Caspian Sea in the Caucasus region .The Caucasus Mountains includes:* the Greater Caucasus Mountain Range and* the Lesser Caucasus Mountains....
area-is just a large or small minority among G persons in such locales as Turkey
Turkey
Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...
, the Middle East
Middle East
The Middle East is a region that encompasses Western Asia and Northern Africa. It is often used as a synonym for Near East, in opposition to Far East...
, Iran
Iran
Iran , officially the Islamic Republic of Iran , is a country in Southern and Western Asia. The name "Iran" has been in use natively since the Sassanian era and came into use internationally in 1935, before which the country was known to the Western world as Persia...
, the southern Caucasus area, China
China
Chinese civilization may refer to:* China for more general discussion of the country.* Chinese culture* Greater China, the transnational community of ethnic Chinese.* History of China* Sinosphere, the area historically affected by Chinese culture...
and India
India
India , officially the Republic of India , is a country in South Asia. It is the seventh-largest country by geographical area, the second-most populous country with over 1.2 billion people, and the most populous democracy in the world...
.
Genetic Features
All G2a3b1 men carry the P303 or S135 SNP Y-DNA mutation. There are also some short tandem repeatShort tandem repeat
A short tandem repeat in DNA occurs when a pattern of two or more nucleotides are repeated and the repeated sequences are directly adjacent to each other. The pattern can range in length from 2 to 5 base pairs and is typically in the non-coding intron region...
(STR) findings among G2a3b1 men which help in subgrouping them. Many of the men have an unusual value of 13 for marker DYS388, and some have 9 at DYS568. STR marker oddities are often different in each G2a3b1 subgroup, and characteristic marker values can vary by subgroup. Often the values of STR markers DYS391, DYS392 and DYS393, however, are respectively 10, 11 and 14 or some slight variation on these for all G2a3b1 men.
P303 first became available for public testing in fall 2008, and the P designation indicates it was identified at the University of Arizona
University of Arizona
The University of Arizona is a land-grant and space-grant public institution of higher education and research located in Tucson, Arizona, United States. The University of Arizona was the first university in the state of Arizona, founded in 1885...
. The mutation is found on the Y chromosome at position 20104736. The forward primer is TTCTTATTTGCTTTGAAACTCAG. The reverse primer is ATTGGCTTATCAGATTGACG. The mutation involves replacement of T by C. This mutation was actually first identified as S135 at Ethnoancestry in London, England, but it took some time to realize that P303, which was independently identified, and S135 were the same.
Dating of G2a3b1 Origin
Research studies have not yet dated the origin of G2a3b1. Based on the number of mutations seen in 67-marker STR values, this P303 mutation perhaps occurred about 5,000 years ago, and the major subgroups developed their mutations several millennia later. The spread to Europe in some subgroups seems to have occurred primarily in the period of 2,500 to 1,500 years ago based on comparisons of samples from Europe west of the Black SeaBlack Sea
The Black Sea is bounded by Europe, Anatolia and the Caucasus and is ultimately connected to the Atlantic Ocean via the Mediterranean and the Aegean seas and various straits. The Bosphorus strait connects it to the Sea of Marmara, and the strait of the Dardanelles connects that sea to the Aegean...
to samples from more easterly locales. Several subgroups may have originated within Europe.
General Old World Geographical Distribution
The distribution information here is based on the large collection of very likely or proven G2a3b1 samples in the Haplogroup G Project derived from multiple sources.G2a3b1 definable subgroups are heavily concentrated in Europe west of Russia
Russia
Russia or , officially known as both Russia and the Russian Federation , is a country in northern Eurasia. It is a federal semi-presidential republic, comprising 83 federal subjects...
and the Black Sea
Black Sea
The Black Sea is bounded by Europe, Anatolia and the Caucasus and is ultimately connected to the Atlantic Ocean via the Mediterranean and the Aegean seas and various straits. The Bosphorus strait connects it to the Sea of Marmara, and the strait of the Dardanelles connects that sea to the Aegean...
, but small numbers are also found in a geographical belt extending from northern Africa to northeastern Asia
Asia
Asia is the world's largest and most populous continent, located primarily in the eastern and northern hemispheres. It covers 8.7% of the Earth's total surface area and with approximately 3.879 billion people, it hosts 60% of the world's current human population...
.
In Europe, the Baltic countries
Baltic countries
The term Baltic states refers to the Baltic territories which gained independence from the Russian Empire in the wake of World War I: primarily the contiguous trio of Estonia, Latvia, Lithuania ; Finland also fell within the scope of the term after initially gaining independence in the 1920s.The...
have the lowest population percentage of G2a3b1. Scandinavia
Scandinavia
Scandinavia is a cultural, historical and ethno-linguistic region in northern Europe that includes the three kingdoms of Denmark, Norway and Sweden, characterized by their common ethno-cultural heritage and language. Modern Norway and Sweden proper are situated on the Scandinavian Peninsula,...
is similar, showing half the percentages of G persons seen in the countries to the south.
G2a3b1 seems to represent the same percentage of the population in both central and southern Europe and usually represents half or more of the G seen in the population in these areas.
Isolated G2a3b1 samples are found also in North Africa (Tunisia
Tunisia
Tunisia , officially the Tunisian RepublicThe long name of Tunisia in other languages used in the country is: , is the northernmost country in Africa. It is a Maghreb country and is bordered by Algeria to the west, Libya to the southeast, and the Mediterranean Sea to the north and east. Its area...
, Libya
Libya
Libya is an African country in the Maghreb region of North Africa bordered by the Mediterranean Sea to the north, Egypt to the east, Sudan to the southeast, Chad and Niger to the south, and Algeria and Tunisia to the west....
and Egypt
Egypt
Egypt , officially the Arab Republic of Egypt, Arabic: , is a country mainly in North Africa, with the Sinai Peninsula forming a land bridge in Southwest Asia. Egypt is thus a transcontinental country, and a major power in Africa, the Mediterranean Basin, the Middle East and the Muslim world...
), in the Middle East
Middle East
The Middle East is a region that encompasses Western Asia and Northern Africa. It is often used as a synonym for Near East, in opposition to Far East...
(Saudi Arabia
Saudi Arabia
The Kingdom of Saudi Arabia , commonly known in British English as Saudi Arabia and in Arabic as as-Sa‘ūdiyyah , is the largest state in Western Asia by land area, constituting the bulk of the Arabian Peninsula, and the second-largest in the Arab World...
and Dubai
Dubai
Dubai is a city and emirate in the United Arab Emirates . The emirate is located south of the Persian Gulf on the Arabian Peninsula and has the largest population with the second-largest land territory by area of all the emirates, after Abu Dhabi...
), the Caucasus Mountains
Caucasus Mountains
The Caucasus Mountains is a mountain system in Eurasia between the Black Sea and the Caspian Sea in the Caucasus region .The Caucasus Mountains includes:* the Greater Caucasus Mountain Range and* the Lesser Caucasus Mountains....
area (Armenia
Armenia
Armenia , officially the Republic of Armenia , is a landlocked mountainous country in the Caucasus region of Eurasia...
, Georgia
Georgia (country)
Georgia is a sovereign state in the Caucasus region of Eurasia. Located at the crossroads of Western Asia and Eastern Europe, it is bounded to the west by the Black Sea, to the north by Russia, to the southwest by Turkey, to the south by Armenia, and to the southeast by Azerbaijan. The capital of...
, Azerbaijan
Azerbaijan
Azerbaijan , officially the Republic of Azerbaijan is the largest country in the Caucasus region of Eurasia. Located at the crossroads of Western Asia and Eastern Europe, it is bounded by the Caspian Sea to the east, Russia to the north, Georgia to the northwest, Armenia to the west, and Iran to...
, N. Ossetia
Ossetia
Ossetia Ossetic: Ир, Ирыстон Ir, Iryston; Russian: Осетия, Osetiya; Georgian: ოსეთი, Oset'i) is an ethnolinguistic region located on both sides of the Greater Caucasus Mountains, largely inhabited by the Ossetians. The Ossetian language is part of the Eastern Iranian branch of the Indo-European...
in Russia, among Russian Kabardinians, Abazinia
Abazinia
Abazinia, Abazashta or Abaza is a historical country at the northern mountainside of the Caucasus Major, now the northern part of Karachay-Cherkessian Republic, Russia. Abazinia is a home of the Abazins, a people related to the Abkhaz people and speaking the Abazin language.Abazinia once was a part...
in Georgia), in Iran
Iran
Iran , officially the Islamic Republic of Iran , is a country in Southern and Western Asia. The name "Iran" has been in use natively since the Sassanian era and came into use internationally in 1935, before which the country was known to the Western world as Persia...
, in Uzbekistan
Uzbekistan
Uzbekistan , officially the Republic of Uzbekistan is a doubly landlocked country in Central Asia and one of the six independent Turkic states. It shares borders with Kazakhstan to the west and to the north, Kyrgyzstan and Tajikistan to the east, and Afghanistan and Turkmenistan to the south....
and among the ethnic groups of northwesternChina
China
Chinese civilization may refer to:* China for more general discussion of the country.* Chinese culture* Greater China, the transnational community of ethnic Chinese.* History of China* Sinosphere, the area historically affected by Chinese culture...
and Russian Siberia
Siberia
Siberia is an extensive region constituting almost all of Northern Asia. Comprising the central and eastern portion of the Russian Federation, it was part of the Soviet Union from its beginning, as its predecessor states, the Tsardom of Russia and the Russian Empire, conquered it during the 16th...
. A distinctive Indian type of G2a3b1 exists, but its prevalence is unclear. And an isolated G2a3b1 sample from Malaysia exists.
Relation to High Mountain Areas?
Undocumented descriptions of the distribution of the more general G2a category in Europe (which actually would be dominated by G2a3b1) have spoken of unusual concentrations of G2a in mountainous area of Europe, such as Switzerland. But based on STR marker samples, SwitzerlandSwitzerland
Switzerland name of one of the Swiss cantons. ; ; ; or ), in its full name the Swiss Confederation , is a federal republic consisting of 26 cantons, with Bern as the seat of the federal authorities. The country is situated in Western Europe,Or Central Europe depending on the definition....
has about the same percentage of haplogroup G as some lower altitude European countries. Sardinia
Sardinia
Sardinia is the second-largest island in the Mediterranean Sea . It is an autonomous region of Italy, and the nearest land masses are the French island of Corsica, the Italian Peninsula, Sicily, Tunisia and the Spanish Balearic Islands.The name Sardinia is from the pre-Roman noun *sard[],...
has a significant amount of a unique type of haplogroup G based on STR marker values, and the percentage of G in the highlands is not unusually higher than for example, in the northern coastal area. There is no noticeable concentration of haplogroup G (and G2a3b1) in the high Alpine areas of Italy
Italy
Italy , officially the Italian Republic languages]] under the European Charter for Regional or Minority Languages. In each of these, Italy's official name is as follows:;;;;;;;;), is a unitary parliamentary republic in South-Central Europe. To the north it borders France, Switzerland, Austria and...
which has a varied landscape. In addition, the high mountainous region east of the Black Sea
Black Sea
The Black Sea is bounded by Europe, Anatolia and the Caucasus and is ultimately connected to the Atlantic Ocean via the Mediterranean and the Aegean seas and various straits. The Bosphorus strait connects it to the Sea of Marmara, and the strait of the Dardanelles connects that sea to the Aegean...
where concentrated pockets of haplogroup G are found contains only tiny amounts of the types of haplogroup G found in Europe proper. Austria
Austria
Austria , officially the Republic of Austria , is a landlocked country of roughly 8.4 million people in Central Europe. It is bordered by the Czech Republic and Germany to the north, Slovakia and Hungary to the east, Slovenia and Italy to the south, and Switzerland and Liechtenstein to the...
is the one European exception where haplogroup G seems more common in the western highest mountains than elsewhere, but much of Austria is mountainous
Concentrations of G2a3b1 at Certain Sites
The highest percentage of G2a3b1 persons in a discrete population so far described is in the island of IbizaIbiza
Ibiza or Eivissa is a Spanish island in the Mediterranean Sea 79 km off the coast of the city of Valencia in Spain. It is the third largest of the Balearic Islands, an autonomous community of Spain. With Formentera, it is one of the two Pine Islands or Pityuses. Its largest cities are Ibiza...
off the eastern Spanish coast. All of the available haplogroup G samples from there are typical G2a3b1 samples based on STR marker values. In total, about 16% of the population is likely G2a3b1 on the same basis.
Ibiza samples include identifiable persons from the DYS388=13 subgroup. Because value combinations of the STR marker samples in Ibiza are also common in Sephardic Jewish samples, the haplogroup G in Ibiza might be related to the significant population of Crypto-Jews in Ibiza.
The percentage of haplogroup G among available samples from Wales
Wales
Wales is a country that is part of the United Kingdom and the island of Great Britain, bordered by England to its east and the Atlantic Ocean and Irish Sea to its west. It has a population of three million, and a total area of 20,779 km²...
is overwhelmingly G2a3b1. Such a high percentage is not found in nearby England
England
England is a country that is part of the United Kingdom. It shares land borders with Scotland to the north and Wales to the west; the Irish Sea is to the north west, the Celtic Sea to the south west, with the North Sea to the east and the English Channel to the south separating it from continental...
, Scotland
Scotland
Scotland is a country that is part of the United Kingdom. Occupying the northern third of the island of Great Britain, it shares a border with England to the south and is bounded by the North Sea to the east, the Atlantic Ocean to the north and west, and the North Channel and Irish Sea to the...
or Ireland
Ireland
Ireland is an island to the northwest of continental Europe. It is the third-largest island in Europe and the twentieth-largest island on Earth...
.
G2a3b1*
The asterisk indicates negativity for G2a3b1's only subgroup. This category was established in April, 2010 because of the determination then, that persons with the L140 SNP mutation comprise a separate subgroup of G2a3b1. So far, only a few samples from IndiaIndia
India , officially the Republic of India , is a country in South Asia. It is the seventh-largest country by geographical area, the second-most populous country with over 1.2 billion people, and the most populous democracy in the world...
, and one each from Spain
Spain
Spain , officially the Kingdom of Spain languages]] under the European Charter for Regional or Minority Languages. In each of these, Spain's official name is as follows:;;;;;;), is a country and member state of the European Union located in southwestern Europe on the Iberian Peninsula...
, Bulgaria
Bulgaria
Bulgaria , officially the Republic of Bulgaria , is a parliamentary democracy within a unitary constitutional republic in Southeast Europe. The country borders Romania to the north, Serbia and Macedonia to the west, Greece and Turkey to the south, as well as the Black Sea to the east...
and Iran
Iran
Iran , officially the Islamic Republic of Iran , is a country in Southern and Western Asia. The name "Iran" has been in use natively since the Sassanian era and came into use internationally in 1935, before which the country was known to the Western world as Persia...
have been identified as belonging to this category.
G2a3b1a (L140+)
Persons in this category have the L140 SNP mutation. L140 was identified at Family Tree DNA in 2009, but the determination that not all G2a3b1 person have this mutation was not made until April, 2010. This mutation is located at chromosome position 7630859, and is a deletion.G2a3b1a1* (U1+, L13-/S13-)
A high percentage of all tested European U1+ persons so far are positive for the subgroup in which the L13 or S13 SNP mutation is present. Preliminary indications are that U1+/L13- persons may be common in the northern Caucasus region and some samples have been found in Armenia as well.
U1 was first identified at the University of Central Florida
University of Central Florida
The University of Central Florida, commonly referred to as UCF, is a metropolitan public research university located in Orlando, Florida, United States...
in 2006 but it was not described in a publication until 2009. The listed technical specifications are:....location rs9785956.....forward primer is TTTCTGCTCCAAATCTGCTG....reverse primer is CACCTGTAATCGGGAGGCTA....the mutation involves a change from A to G.
G2a3b1a1a (U1+, L13+/S13+)
This second most populous G2a3b1 subgroup is characterized by the presence of the L13/S13 SNP. Almost all L13+ persons of European ancestry have the value of 12 or 13 at STR marker DYS385a and values of 19,20 at STR marker YCA. There are a few L13+ samples available which lack these mutations, and a shared common ancestor farther back in time from the others can be presumed for these samples.
The L13/S13 SNP was first identified at the University of Central Florida
University of Central Florida
The University of Central Florida, commonly referred to as UCF, is a metropolitan public research university located in Orlando, Florida, United States...
in 2006 as the U13 SNP, but prior to the publication of the details of this research in 2009, the SNP was also independently identified in 2008 at Family Tree DNA in Houston, Texas, as L13 and at Ethnoancestry in England as S13 and made available for public testing. The technical specifications are given as.....Y chromosome location rs9786706.....forward primer is GTGGTAACAGCTCCTGGTGAG.....reverse primer is TGCTGCTTTGGTTAACTGTCC...the mutation involves a change from C to T.
The G2a3b1a1a subgroup is most common in north central Europe and is found in almost all places in Europe where other types of G are seen, but this subgroup seems rare in almost all countries outside Europe. Some atypical marker values seen outside Europe make L13+ persons hard to identify based on marker values, and the L13+ status may be more common in such places as the Caucasus Mountain region than presently suggested. The Haplogroup G Project has also collected samples from the Middle East, Iran and Caucasus Mountain region with mutated marker values similar to the European G2a3b1a1 men, especially at STR markers DYS385 and YCA. But the similarities could be only coincidental due to lack of SNP testing.
The common ancestor of almost all European L13+ men seems to have lived at least 2,500 years ago based on comparative 67-marker STR samples, and the mutation itself may be about 3,000 years old based on the same data.
The Haplogroup G Project has indicated among its large G collection that likely or proven G2a3b1a1 STR samples comprise the following percentages of available G samples in the following European countries [in descending order]:
Germany, 16%.....Italy, 11%.....Netherlands, 10%.....France, 10%.....Poland, 9%.....Spain, 9%.....Ireland, 6%.....England, 5%.....Switzerland, 4%
The L497+ G2a3b1a2 Subgroups
The largest G2a3b1a subgroup in Europe based on available samples is G2a3b1a2 in which men have the L497 mutation. This SNP was first identified in January, 2011, in testing at 23andMe23andMe
23andMe is a privately held personal genomics and biotechnology company based in Mountain View, California that is developing new methods and technologies that will enable consumers to understand their own genetic information...
and made available for separate testing at L497 by Family Tree DNA. The chromosome locations are given as 15932714 and rs35141399, and the mutation is from C to T. The forward primer is ATGAGTGGCCTCACCAAGGGAATC and reverse primer is ATGGGCAACAGGTGTCCTGAAG.
A high percentage of men with L497 have the value of 13 at STR marker DYS388. This is a rare mutation from the ancestral value of 12. A very small number of men within this DYS388=13 subgroup seem to have mutated yet again to 12 or 14. The geographical distribution of this 13 mutation and other features were first described in a research journal in 2007. Percentages of DYS388=13 men within G samples are particularly high in northwestern Europe. Some DYS388=13 subgroups below are based on SNP mutations and others on STR marker value oddities.
The Haplogroup G Project has indicated among its large G collection that likely or proven STR samples from the DYS388=13 type of G2a3b1a comprise the following percentages of available G samples in the following countries [in descending order]:
Switzerland, 74%.....Spain, 60%.....France, 58%....Germany, 57%.....England, 54%....Ireland, 48%.....Netherlands, 45%.....Italy, 43%....Poland, 29%....India, 0%
The Polish percentage of DYS388=13 men is diminished solely because of the origins of a significant group of G2c men in that country. Without the G2c group, the DYS388=13 percentage is 50%. The German G samples are much more numerous in the southwestern part of the country.
While DYS388=13 G persons are found in Iran, so far all such samples have been found not at all related to the DYS388=13 persons of Europe. Apparently the mutation to 13 occurred independently in other G categories in that country. The only non-European DYS388=13 sample that has surfaced from the Old World
Old World
The Old World consists of those parts of the world known to classical antiquity and the European Middle Ages. It is used in the context of, and contrast with, the "New World" ....
that has similar STR marker values to the Europeans is a single sample from Egypt.
The age of the mutation of DYS388 to 13 seems at least 2,500 yrs old based on comparison of 67-marker STR samples. The paucity of proven samples from outside Europe so far leaves open the possibility this DYS388 mutation originated in a European.
G2a3b1a2a (L43+/S147+, L42-/S146-)
This G2a3b1a2a subgroup is rare because virtually all tested L43+/S147+ persons so far are also L42+/S146+.
The SNP that characterizes G2a3b1a2a was first identified in a listing of SNP results from testing at 23andMe
23andMe
23andMe is a privately held personal genomics and biotechnology company based in Mountain View, California that is developing new methods and technologies that will enable consumers to understand their own genetic information...
. It was independently developed as a separate test by both Family Tree DNA as L43 and by Ethnoancestry as S147. In fall 2009 a test again at 23andMe provided information for the first time that a person who had the L43 mutation simultaneously lacked the L42 mutation that typically occurs with L43. This anomaly was verified by testing the same person at Family Tree DNA. So L43+/S147+ is now a separate category. The technical specifications for L43 are as follows: Y chromosome location 16446759....forward primer is GAGGTTTTCGGAGCTTACCTATAC....reverse primer is CACTGCTTGTAGATAGTAAAGTTTG.....the mutation involves change from A to G.
G2a3b1a2a1 (L43+/S147+, L42+/S146+)
About a fourth of DYS388=13 men have this L42/S146 mutation. Swiss G2a3b1a men are more likely than average to belong to this subgroup. L42/S146 could be nearly as old as the DYS388=13 mutation (over 2,500 yrs.) based on the number of value differences seen in 67-marker STR samples.
The SNP that characterizes G2a3b1a2a was first identified in a listing of SNP results from testing at 23andMe
23andMe
23andMe is a privately held personal genomics and biotechnology company based in Mountain View, California that is developing new methods and technologies that will enable consumers to understand their own genetic information...
. It was independently developed as a separate test by both Family Tree DNA as L42 and by Ethnoancestry as S146. The technical specifications for this SNP are as follows:....position on Y chromosome is 15170153.....forward primer is CTCACAATAGGCAGCATCCCCTCAG.....reverse primer is CAGAAAAAGGGAGCATATGACCAAGG.....the mutation involves a change from C to A.
G2a3b1a2a1a (rs34136765=T+)
This mutation was found in a raw data file of a man with an English/Scottish surname at 23andMe in summer 2010. The mutation is from C to T. Another designation for the chromosome location is 15862538. This mutation so far is found only in a single person, and four other G2a3b1a2a men tested negative (ancestral) for this mutation. It is yet to be determined if this SNP is found only in the family of the positive man or has more general coverage. It is to be noted that the man with this mutation has a large loss of repeats at STR marker DYS413a. There is at least one other man genetically near to him with the same DYS413a oddity. Whichever mutation is eventually determined to be more recent will become a subgroup of the other.
L297+
This mutation was identified at Family Tree DNA in summer 2010. The mutation is from G to T. The chromosome location is 15170096. This mutation so far is found only in a single person, and seven other G2a3b1a2a men tested negative (ancestral) for this mutation. It is yet to be determined if this SNP is found only in the family of the positive man or has more general coverage.
L139+
The L139 SNP was found so far only in one DYS388=13 man, and it is uncertain if this SNP is only familial or has slightly broader coverage. For sure, L139 is not common because multiple other DYS388=13 men have tested negative for L139. The L139+ man is known negative (ancestral) for the L43 and L42 SNPs.
SNP L139 was first identified at Family Tree DNA in Houston, Texas, in mid-2009 and made available for testing at that time. The technical specifications for L139 are as follows:.....located at 13981304 on Y-chromosome.....the mutation involves change from G to A.
L486+
The rs2538860 region of the Y-chromosome with a finding of A+ was determined in one DYS388=13 man during testing at 23andMe
23andMe
23andMe is a privately held personal genomics and biotechnology company based in Mountain View, California that is developing new methods and technologies that will enable consumers to understand their own genetic information...
, and it is uncertain if this SNP is only familial or has slightly broader coverage. For sure, this mutation is not common since multiple other DYS388=13 men who have tested negative for this. The man with the mutation is known negative (ancestral) for the L43 and L42 SNPs. None of the commercial labs have yet provided a shortened name, such as L139, for this mutation.
The mutation at rs2538860 was first identified in a raw data file at 23andMe, in June 2010. The technical specifications are as follows:.....located at 10342008 on Y-chromosome.....the mutation involves change from C to A.
DYS391=7
This multi-value (multistep) mutation at STR marker DYS391 to the value of 7 from the original 10 is found in a group of Hispanic
Hispanic
Hispanic is a term that originally denoted a relationship to Hispania, which is to say the Iberian Peninsula: Andorra, Gibraltar, Portugal and Spain. During the Modern Era, Hispanic sometimes takes on a more limited meaning, particularly in the United States, where the term means a person of ...
men. No information is available about their L42 and L43 status.
DYS464a=9
This multi-value (multistep) mutation at STR marker DYS464a to the value of 9 is found so far only in Swiss and German men. No information is available about their L42 and L43 status.
DYS388=15
This small subgroup is composed of men whose ancestor mutated two values at STR marker DYS388 to 15. Members of this subgroup must have other marker values similar to persons in the overall DYS388=13 subgroup. So far only persons of English ancestry belong to this DYS388=15 subgroup. Marker DYS388 rarely mutates, and a two-step (two-value) mutation is almost as valuable as a SNP mutation in identifying persons within this distinctive subgroup.
DYS393=12 with Genetic Nearness
This small subgroup is composed of men whose ancestor mutated at STR marker DYS393 to 12. This marker value is unusually low for G persons. The persons with this finding seem to report ancestral origins primarily in Cyprus
Cyprus
Cyprus , officially the Republic of Cyprus , is a Eurasian island country, member of the European Union, in the Eastern Mediterranean, east of Greece, south of Turkey, west of Syria and north of Egypt. It is the third largest island in the Mediterranean Sea.The earliest known human activity on the...
based on current knowledge.
DYS594=12 with Genetic Nearness
While a mutation to a value of 12 from 10 or 11 is seen primarily in this group, there exist a few DYS594=12 men who do not belong to the group. The men in this group form a distinctive cluster of persons with closely related STR marker values in addition to the DYS594 oddity. This DYS594=12 subgroup has an unusually high percentage of Welsh surnames with the rest mostly of English ancestry based on available samples. Multiple persons in this group have tested negative for the L43 and L42 SNP mutations.
DYS568=9 Subgroup containing G2a3b1a3
The final major subgroup is characterized in a high percentage of cases by the values of 9 at STR marker DYS568 and less reliably 20,21 at marker YCA together with a close relationship based on STR marker values. The reason DYS568=9 can be used as a generally reliable categorization value is due to the fact this represents a multi-step mutation in a very slowly mutating marker. Although not the subject of a research study, the age of the mutation to 9 at DYS568 may have been about 3,000 yrs. ago based on the number of marker value differences of 67-marker STR samples. And the mutation to 20,21 at YCA would have arisen in this same general time period. Persons within the DYS568=9 group who were tested for the marker GATA-A10 had values one or more higher than found in other haplogroup G subgroups. Those from the Ashkenazi cluster had the highest values of 14. Additional results would be needed to determine if these findings are consistent within the DYS568=9 group.No DYS568=9 persons have been located in the Middle East or Anatolia region where haplogroup G can be unusually common. Several samples, however, have been found among Ossetians in the central Caucasus Mountains. Though found all over Europe, DYS568=9 is so far missing from Scandinavian samples north of Denmark.
This DYS568=9 subgroup contains a further large subgroup consisting of Ashkenazi Jews who are relatively closely related based on STR marker values and typically have a value of 16 for marker DYS385b. The Jewish cluster does not seem to share a common ancestor with the non-Jewish men within the Current Era. And the common ancestor of the Ashkenazi DYS568=9 men likely lived in the Middle Ages based on the small number of STR marker value difference seen among them. See also page covering Jews with Haplogroup G (Y-DNA)
Jews with Haplogroup G (Y-DNA)
There are significant numbers of Jewish men found within multiple subgroups of haplogroup G . Haplogroup G is found in significantly different percentages within the various Jewish ethnic divisions, ranging from about a third of Moroccan Jews to almost none reported among the Indian, Yemenite and...
.
There is another, smaller subgroup of DYS568=9 persons who have the value of 9 at STR marker DYS439. The ancestral value for this marker is 12 within the DYS568=9 group, and this 9 represents a rare multi-step mutation. This DYS439=9 subgroup is predominantly German, and the mutation is probably over 2,000 years old based on number of marker value differences in 67-marker STR samples.
The Haplogroup G Project has indicated among its large G collection that likely or proven DYS568=9 samples comprise the following percentages of available G samples in the following countries [in descending order]:
Ireland, 12%.....England, 9%.....Netherlands, 5%.....Poland, 5%.....Italy, 4%.....Germany, 3%.....Spain, 3%.....France, 2%.....Switzerland, 0%
Within the DYS568=9 subgroup -- which lacks its own SNP -- is subgroup G2a3b1a3 (L640+). This is a small group of men presently all from the British Isles. This SNP was identified in summer 2011 at Family Tree DNA. It represents a mutation from A to G and is found at position 16903082 on the Y chromosome. Most, if not all, these L640+ men also have the value of 8 at marker DY533 which is otherwise rare among DYS568=9 men.
G2a3b1a4 (L660+, L662+)
This G2a3b1a4 subgroup is a small one, and so far found only in Europeans. Both SNPs involved were first identified at Family Tree DNA in summer 2011. L660 is found at position 12511525 on the Y chromosome and isa change from C to A. L662 is found at position 16446702 and is a change from C to T.
G2a3b1b (L694+)
Persons in this subgroup have the L694 mutation which was discovered at Family Tree DNA in summer 2011. So far, this mutation has been found primarily in Polish men. It is located at position 5734987 on the Y chromosome and is an insertion mutation.See also
- Genetic genealogyGenetic genealogyGenetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy involves the use of genealogical DNA testing to determine the level of genetic relationship between individuals.-History:...
- Y-DNA haplogroups by ethnic groupsY-DNA haplogroups by ethnic groupsListed here are notable ethnic groups by Y-DNA haplogroups based on relevant studies. The data is presented in two columns for each haplogroup with the first being the sample size and the second the percentage in the haplogroup designated by the column header...
- Haplogroup G (Y-DNA) Country by CountryHaplogroup G (Y-DNA) Country by CountryIn human genetics, Haplogroup G is a Y-chromosome haplogroupNone of the sampling done by research studies shown here would qualify as true random sampling, and thus any percentages of haplogroup G provided country by country are only rough approximations of what would be found in the full population...