Haplogroup G2c (Y-DNA)
Encyclopedia
In human genetics
Human genetics
Human genetics describes the study of inheritance as it occurs in human beings. Human genetics encompasses a variety of overlapping fields including: classical genetics, cytogenetics, molecular genetics, biochemical genetics, genomics, population genetics, developmental genetics, clinical genetics,...

, Haplogroup G2c (formerly G5) is a Y-chromosome haplogroup
Human Y-chromosome DNA haplogroups
In human genetics, a Human Y-chromosome DNA haplogroup is a haplogroup defined by differences in the non-recombining portions of DNA from the Y chromosome ....

 and is defined by the presence of the M377 mutation. It is a branch of Haplogroup G
Haplogroup G (Y-DNA)
In human genetics, Haplogroup G is a Y-chromosome haplogroup. It is a branch of Haplogroup F . Haplogroup G has an overall low frequency in most populations but is widely distributed within many ethnic groups of the Old World in Europe, northern and western Asia, northern Africa, the Middle East,...

, which in turn is defined by the presence of the M201 mutation.

G2c is a major Y chromosome haplogroup, and yet unique: It has a very high frequency in Ashkenazi Jews
Ashkenazi Jews
Ashkenazi Jews, also known as Ashkenazic Jews or Ashkenazim , are the Jews descended from the medieval Jewish communities along the Rhine in Germany from Alsace in the south to the Rhineland in the north. Ashkenaz is the medieval Hebrew name for this region and thus for Germany...

, and shows strong evidence of a very recent settlement in Europe. (See also page covering Jews with Haplogroup G (Y-DNA)
Jews with Haplogroup G (Y-DNA)
There are significant numbers of Jewish men found within multiple subgroups of haplogroup G . Haplogroup G is found in significantly different percentages within the various Jewish ethnic divisions, ranging from about a third of Moroccan Jews to almost none reported among the Indian, Yemenite and...

). The TMRCA (time until most recent common ancestor) appears to be around 1100 CE for this close group of Ashkenazi Jews. It is rare outside of northern Europe but there is recent evidence that this haplogroup is also found in certain Lebanese Christian populations originating from southern Syria and it has been found in a single Turk
Turkish people
Turkish people, also known as the "Turks" , are an ethnic group primarily living in Turkey and in the former lands of the Ottoman Empire where Turkish minorities had been established in Bulgaria, Cyprus, Bosnia and Herzegovina, Georgia, Greece, Kosovo, Macedonia, and Romania...

 from Kars Province
Kars Province
Kars Province is a province of Turkey, located in the northeastern part of the country. It shares part of its border with the Republic of Armenia.The provinces of Ardahan and Iğdır were until the 1990s part of Kars Province.-History:...

 in Turkey
Turkey
Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...

 on the border with Armenia
Armenia
Armenia , officially the Republic of Armenia , is a landlocked mountainous country in the Caucasus region of Eurasia...

, a Pashtun from the area of Pakistan bordering Afghanistan in the Hindu Kush
Hindu Kush
The Hindu Kush is an mountain range that stretches between central Afghanistan and northern Pakistan. The highest point in the Hindu Kush is Tirich Mir in the Chitral region of Khyber-Pakhtunkhwa, Pakistan.It is the westernmost extension of the Pamir Mountains, the Karakoram Range, and is a...

 range, and a single Burusho from the Hunza Valley
Hunza Valley
The Hunza Valley is a mountainous valley in the Gilgit-Baltistan region of Pakistan. The Hunza valley is situated to the north of the Hunza River, at an elevation of around . The territory of Hunza is about...

 in the Karakorum Range in Kashmir. Recently, it was discovered that an Egyptian and a Jordanian have values very similar to the Lebanese G2c group. It is confirmed that a sample from Sicily
Sicily
Sicily is a region of Italy, and is the largest island in the Mediterranean Sea. Along with the surrounding minor islands, it constitutes an autonomous region of Italy, the Regione Autonoma Siciliana Sicily has a rich and unique culture, especially with regard to the arts, music, literature,...

 was G2c and the common ancestor between the Jewish group and this lone Sicilian match up to the time Titus brought the Jews out of Judea. This Jewish group could very well be Italkim Jews (Italian Jews
Italian Jews
Italian Jews can be used in a broad sense to mean all Jews living or with roots in Italy or in a narrower sense to mean the ancient community who use the Italian rite, as distinct from the communities dating from medieval or modern times who use the Sephardi or Ashkenazi rite.-Divisions:Italian...

); which would explain why it was never found amongst Sephardi Jews
Sephardi Jews
Sephardi Jews is a general term referring to the descendants of the Jews who lived in the Iberian Peninsula before their expulsion in the Spanish Inquisition. It can also refer to those who use a Sephardic style of liturgy or would otherwise define themselves in terms of the Jewish customs and...

 (those with origins in Spain or Portugal) and would explain it's rather late arrival into Eastern Europe.

G2c presents more mysteries regarding its origin and distribution than virtually any other major Y haplogroup. Haplogroups that are rare in certain regions are more common in another, and have rather clear origins in other places where they are more commonly found. G2c has none of these obvious characteristics. It is most common by far in a region where it arrived very recently, but rare in other region including its likely area of origin. The distribution of G2c is sparse and dispersed, with almost no G2c haplotypes found in very large intervening regions. This pattern is unique among Y haplogroups.

Phylogenetic position

Extensive single nucleotide polymorphism
Single nucleotide polymorphism
A single-nucleotide polymorphism is a DNA sequence variation occurring when a single nucleotide — A, T, C or G — in the genome differs between members of a biological species or paired chromosomes in an individual...

 (SNP) testing by the Haplogroup G SNP project found that G2c is an independent branch of haplogroup G characterized by only one SNP, M377. A forthcoming study by the Y Chromosome Consortium at the University of Arizona found that within haplogroup G, G2c and G2 share a new SNP, P287, which is not found in the other well-attested branch of G, haplogroup G1. As a result, it will be proposed that Haplogroup G5 be renamed "G2c".

Distinguishing Y-STR alleles

For the full listing of all the G2c Y-STR
Y-STR
A Y-STR is a short tandem repeat on the Y-chromosome. Y-STRs are often used in forensics, paternity, and genealogical DNA testing.-Nomenclature:Y-STRs are assigned names by the HUGO gene nomenclature committee....

 modal haplotype values, see the entry:
HRGEN in ySearch.org

All G2c samples tested so far have a null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic Y-STR, the result of a RecLOH
RecLOH
RecLOH is a term in genetics that is an abbreviation for "Recombinational Loss of Heterozygosity".This is a type of mutation which occurs with DNA by recombination. From a pair of equivalent , but slightly different genes, a pair of identical genes results...

 event. This change is extremely uncommon in the rest of haplogroup G, but apparently happened early in the history of G2c.
G2c Y-STR distinguishing allele values
Y-STR Allele range Modals
DYS393 12-13 13
DYS390 23-24 23
DYS19 15-17 15
17
DYS391 10-12 10
11
DYS385* 13,15
13,16
13,17
14,16
13,16
DYS426 11
DYS388 12
DYS439 11-12 11
DYS392 11
DYS389 13,29
13,30
13,31
14,31
14,32
14,33
15,33
13,30
14,31
14,32
DYS459 8,9
DYS464 13,13,14,15
13,13,15,15
13,14,14,15
13,14,15,15
13,14,15,15
DYS607 15-17 16
DYS395S1a 16,16
DYS425 null
DYS413 21,22
DYS436 11
DYS481 19
DYS461 12

* In haplogroup G2c, according to the Kittler Protocol for DYS385 which tests for the actual order of the DYS385 alleles along the Y chromosome, the smaller allele precedes the larger and therefore the allele sequence given here is physically correct.

Primer sequence

SNP
name
gene gene
location
Y position
M377 DDX3Y intron 10 15,536,827
Primer (5'→3')
position
(bp)
SNP forward reverse length
(bp)
40 A→T tatgcatttgttgagtatatgtc gttctgaatgaaagttcaaacg 326

Ashkenazi Jews

A cluster of closely related Ashkenazi Jews
Ashkenazi Jews
Ashkenazi Jews, also known as Ashkenazic Jews or Ashkenazim , are the Jews descended from the medieval Jewish communities along the Rhine in Germany from Alsace in the south to the Rhineland in the north. Ashkenaz is the medieval Hebrew name for this region and thus for Germany...

 represent virtually all confirmed G2c persons worldwide, both from private testing, and from academic studies. Of 211 known European G2cs, 8 are known to have non-Jewish patrilineal ancestors. G2c makes up about 7% of all Ashkenazi Jewish Y chromosome haplotypes, as was found in Behar et al. (2004) (n=442, GxG2=33). In the supplemental data from Behar et al. (2004), among the Ashkenazi Jewish G haplotypes haplotypes 4 and 6-15 are G2c, 2,3,5 are G1, and the haplogroup of the first listed is unclear. A much smaller group of Ashkenazi Jews however are in haplogroup G1, so not all GxG2 Ashkenazi Jews in the above study would be G2c. In a sample of 955 haplogroup G haplotypes, there are 103 Ashkenazi G2cs and 14 Ashkenazi G1s. The ratio of G2c:G1 among Ashkenazi Jews is approximately 10:1.

Eastern Europe

The distribution of G2c in Eastern Europe very closely reflects the 16th and 17th century settlement patterns of Ashkenazi Jews in the Polish-Lithuanian Commonwealth
History of Poland (1569–1795)
The Nihil novi act adopted by the Polish Diet in 1505 transferred all legislative power from the king to the Diet. This event marked the beginning of the period known as "Nobles' Democracy" or "Nobles' Commonwealth" when the state was ruled by the "free and equal" Polish nobility...

:

Western Germany

G2c is also found among Ashkenazi Jews from Western Germany. Jews were not allowed to reside in most parts of Germany in the 16th and 17th centuries, aside from the Frankfurt Jewish Ghetto
Frankfurter Judengasse
The Frankfurter Judengasse was the Jewish ghetto of Frankfurt and one of the earliest ghettos in Germany. It existed from 1462 until 1796 and was home to Germany's largest Jewish community in early modern times....

. Jews were expelled in 1670 from Vienna and the Archduchy of Austria. After Khmelytsky's Pogrom in Poland in 1648, there began a migration of Jews from Poland and Lithuania to Western Germany, which accelerated and continued into the 19th century. It isn't clear at this point whether German Jewish G2cs represent an independent settlement, or the result of a migration from Eastern Europe (although there is some evidence for the latter).

Southern Italy and Sicily

Among Europeans, there are a few significant exceptions to this almost exclusive Ashkenazi Jewish distribution - out of 211 known European G2cs, there are 4 Sicilians, including 3 members of one family with a tradition of Jewish patrilineal descent from 16th century Sicily
Sicily
Sicily is a region of Italy, and is the largest island in the Mediterranean Sea. Along with the surrounding minor islands, it constitutes an autonomous region of Italy, the Regione Autonoma Siciliana Sicily has a rich and unique culture, especially with regard to the arts, music, literature,...

.

Southwest Syria

It appears as if there are a few individuals of Syrian descent that also share this haplogroup. However, their split from the rest of the group should be a minimum of 2,000 years with further testing. It appears as if this group will fall into the G2c* group and not the G2c1 group with the Pashtuns.

Eastern Anatolia

A confirmed G2c Y-STR haplotype found in the literature is haplotype 54 from a study of Anatolian Y chromosomes (n=523) by Cinnioglu et al. (2004) which was found in Eastern Turkey, in the city of Kars
Kars
Kars is a city in northeast Turkey and the capital of Kars Province. The population of the city is 73,826 as of 2010.-Etymology:As Chorzene, the town appears in Roman historiography as part of ancient Armenia...

, very close to Armenia
Armenia
Armenia , officially the Republic of Armenia , is a landlocked mountainous country in the Caucasus region of Eurasia...

.

The Hindu Kush and Kashmir (Pakistan)

There are just two other confirmed G2c samples that have been publicly reported in the academic literature so far, one Pashtun
Pashtun people
Pashtuns or Pathans , also known as ethnic Afghans , are an Eastern Iranic ethnic group with populations primarily between the Hindu Kush mountains in Afghanistan and the Indus River in Pakistan...

 in the Khyber Pakhtunkhwa province of Pakistan (the Hindu Kush Range
Hindu Kush
The Hindu Kush is an mountain range that stretches between central Afghanistan and northern Pakistan. The highest point in the Hindu Kush is Tirich Mir in the Chitral region of Khyber-Pakhtunkhwa, Pakistan.It is the westernmost extension of the Pamir Mountains, the Karakoram Range, and is a...

), and one Burusho in the Hunza Valley
Hunza Valley
The Hunza Valley is a mountainous valley in the Gilgit-Baltistan region of Pakistan. The Hunza valley is situated to the north of the Hunza River, at an elevation of around . The territory of Hunza is about...

 in Kashmir
Kashmir
Kashmir is the northwestern region of the Indian subcontinent. Until the mid-19th century, the term Kashmir geographically denoted only the valley between the Great Himalayas and the Pir Panjal mountain range...

. These two G2cs are Y-STR
Y-STR
A Y-STR is a short tandem repeat on the Y-chromosome. Y-STRs are often used in forensics, paternity, and genealogical DNA testing.-Nomenclature:Y-STRs are assigned names by the HUGO gene nomenclature committee....

 haplotypes 731 and 794 from Table 3 in the study by Sengupta et al. (2006) of Indian (n=728), Pakistani (n=176), and East Asian (n=175) Y chromosome lineages. Firasat et al. (2007) found 1 G among 97 Burushos, and in Sengupta et al. (2006) the only Burusho G was G2c, making it likely that this single G is G2c as well. The YHRD European forensic database has several haplotypes from Pakistan that are very likely to be G2c, including 1 Burusho (n=94) and 5 Pashtuns (n-93).

Hunza

Hunza was an important stop on the Silk Road
Silk Road
The Silk Road or Silk Route refers to a historical network of interlinking trade routes across the Afro-Eurasian landmass that connected East, South, and Western Asia with the Mediterranean and European world, as well as parts of North and East Africa...

 from the Near East
Near East
The Near East is a geographical term that covers different countries for geographers, archeologists, and historians, on the one hand, and for political scientists, economists, and journalists, on the other...

 to China
China
Chinese civilization may refer to:* China for more general discussion of the country.* Chinese culture* Greater China, the transnational community of ethnic Chinese.* History of China* Sinosphere, the area historically affected by Chinese culture...

. The fertile Hunza Valley
Hunza Valley
The Hunza Valley is a mountainous valley in the Gilgit-Baltistan region of Pakistan. The Hunza valley is situated to the north of the Hunza River, at an elevation of around . The territory of Hunza is about...

 was the last resting point before the Khunjerab Pass
Khunjerab Pass
Khunjerab Pass is a high mountain pass in the Karakoram Mountains in a strategic position on the northern border of Pakistan's Gilgit-Baltistan region within the disputed region of Kashmir and on the southwest border of the Xinjiang region of China...

 (el. 4693 m./15397 ft.) which was the highest point on the southern route of the Silk Road from Iran
Iran
Iran , officially the Islamic Republic of Iran , is a country in Southern and Western Asia. The name "Iran" has been in use natively since the Sassanian era and came into use internationally in 1935, before which the country was known to the Western world as Persia...

, the Indian Ocean
Indian Ocean
The Indian Ocean is the third largest of the world's oceanic divisions, covering approximately 20% of the water on the Earth's surface. It is bounded on the north by the Indian Subcontinent and Arabian Peninsula ; on the west by eastern Africa; on the east by Indochina, the Sunda Islands, and...

 ports of the Makran
Makran
The present day Makran is a semi-desert coastal strip in the south of Sindh, Balochistan, in Iran and Pakistan, along the coast of the Arabian Sea and the Gulf of Oman. The present day Makran derived its name from Maka, a satrap of Achaemenid Empire....

 Coast in Pakistan
Pakistan
Pakistan , officially the Islamic Republic of Pakistan is a sovereign state in South Asia. It has a coastline along the Arabian Sea and the Gulf of Oman in the south and is bordered by Afghanistan and Iran in the west, India in the east and China in the far northeast. In the north, Tajikistan...

, to the Kashgar
Kashgar
Kashgar or Kashi is an oasis city with approximately 350,000 residents in the western part of the Xinjiang Uyghur Autonomous Region of the People's Republic of China. Kashgar is the administrative centre of Kashgar Prefecture which has an area of 162,000 km² and a population of approximately...

 oasis in the Gobi Desert
Gobi Desert
The Gobi is a large desert region in Asia. It covers parts of northern and northwestern China, and of southern Mongolia. The desert basins of the Gobi are bounded by the Altai Mountains and the grasslands and steppes of Mongolia on the north, by the Hexi Corridor and Tibetan Plateau to the...

 of western China
China
Chinese civilization may refer to:* China for more general discussion of the country.* Chinese culture* Greater China, the transnational community of ethnic Chinese.* History of China* Sinosphere, the area historically affected by Chinese culture...

. Among the Burusho South Asian Y haplogroups predominate, but there are some representatives of Central Asian (C3
Haplogroup C3 (Y-DNA)
In human genetics, Haplogroup C3 is a Y-chromosome DNA haplogroup mainly found in indigenous Siberians, Kazakhs and Mongolians. Haplogroup C3 is the most widespread and frequently occurring branch of the greater Haplogroup C...

) and East Asian (O3
Haplogroup O3 (Y-DNA)
In human genetics, Haplogroup O3 is a Y-chromosome haplogroup.-Origins:Haplogroup O3 is a descendant haplogroup of haplogroup O. Some researchers believe that it first appeared in China approximately 10,000 years ago, while others believe it to have had an origin in Southeast Asia approximately...

) haplogroups as well. Sengupta et al. (2006) found the Burushos to be completely lacking in haplogroup G2a which is well-represented among the nearby Kalash
Kalash
Kalasha or Kalash may refer to:*Kalash people of Chitral, northern Pakistan**Kalasha **Kalash language, also known as Kalasha-mondr**Kalasha Desh, their valleys*Nuristani people of Nuristan, Afghanistan...

 and Pashtun
Pashtun people
Pashtuns or Pathans , also known as ethnic Afghans , are an Eastern Iranic ethnic group with populations primarily between the Hindu Kush mountains in Afghanistan and the Indus River in Pakistan...

 populations.
Historical background of the Ani region

In 894
894
Year 894 was a common year starting on Tuesday of the Julian calendar.- Europe :* Northumbrians and East Angles swear allegiance to Alfred the Great, but promptly break their truce by attacking the south-west of England.* Mojmír II becomes King of Great Moravia after the death of his father...

 CE, the Bagratid
Bagratuni Dynasty
The Bagratuni, Bagratid or alternatively Pakradouni royal dynasty of Armenia was a royal family whose branches formerly ruled many regional polities, including the Armenian lands of Sper|presently Ispir in Tayk Province of the Armenian Kingdom, Bagrevand in Ayrarat Province of the Armenian...

 Prince Ashot I was given the title of King of Armenia by the Abbasid Caliphate  and briefly established his capital at the ancient Armenian center of Bagaran
Bagaran
Bagaran is a town and former fortress in the Armavir Province of Armenia, located 5 kilometers west of the right bank of the Akhurian River, and formerly a capital of Armenia....

 40 km south of Ani, and then moved it to Shirakavan
Shirakavan
Shirakavan also known by the name Yerazgavors was a medieval Armenian town that, during the 9th century AD, served as the capital for the Bagratid Kingdom of Armenia...

, 15 km northeast of Ani. In 929
929
Year 929 was a common year starting on Thursday of the Julian calendar.- Asia :* Mpu Sindok, ruler of the Mataram Kingdom, moves his court from Central Java to East Java in Indonesia.- Europe :...

 the capital was transferred to Kars, 42 km west of Ani, and then in 969
969
Year 969 was a common year starting on Friday of the Julian calendar.- Byzantine Empire :* December 11 – John I Tzimiskes becomes Byzantine Emperor after assassinating Nikephoros II Phokas....

 to Ani itself. Ani in the 10th and 11th centuries had a population as high as 100,000 - 200,000. The city continued to flourish even after the capture of Ani in 1064 by the Seljuks under Alp Arslan
Alp Arslan
Alp Arslan was the third sultan of the Seljuq dynasty and great-grandson of Seljuk, the eponymous founder of the dynasty...

, and the subsequent rule by the Kurdish Muslim Shaddadid
Shaddadid
The Shaddadids were a Kurdish dynasty who ruled in various parts of Armenia and Arran from 951-1174 AD. They were established in Dvin. Through their long tenure in Armenia, they often intermarried with the Bagratuni royal family of Armenia....

 dynasty from 1072-1199. In 1199 Ani was captured by the forces of Queen Tamar of Georgia
Tamar of Georgia
Tamar , of the Bagrationi dynasty, was Queen Regnant of Georgia from 1184 to 1213. Tamar presided over the "Golden age" of the medieval Georgian monarchy...

 and a Georgian vassal kingdom was created which was ruled by the Zakarid dynasty. In 1236, the Mongols
Mongols
Mongols ) are a Central-East Asian ethnic group that lives mainly in the countries of Mongolia, China, and Russia. In China, ethnic Mongols can be found mainly in the central north region of China such as Inner Mongolia...

 captured Ani, killing many of its inhabitants, but afterward it was continued to be ruled by the Georgian Zakarids. After its capture by the Turkic Kara Koyunlu
Kara Koyunlu
The Kara Koyunlu or Qara Qoyunlu, also called the Black Sheep Turkomans , were a Shi'ite Oghuz Turkic tribal federation that ruled over the territory comprising the present-day Armenia, Azerbaijan, north-western Iran, eastern Turkey and Iraq from about 1375 to 1468.The Kara Koyunlu Turkomans at one...

 in the 1330s, Ani declined rapidly. The Kara Koyunlu moved their capital to Yerevan
Yerevan
Yerevan is the capital and largest city of Armenia and one of the world's oldest continuously-inhabited cities. Situated along the Hrazdan River, Yerevan is the administrative, cultural, and industrial center of the country...

 in 1446 and by the 18th century Ani had been completely abandoned.

There is no evidence that Ani or the adjacent areas ever had a Jewish population in the Medieval period. There may have been an early presence of Jews in the Kingdom of Armenia in late Hellenistic and Roman times before the conversion of Armenia to Christianity, However, the possible presence of G2c almost exclusively in the region of the Medieval capitals of Armenia, Bagaran, Shirakavan, Kars, and Ani would indicate that, if indeed these haplotypes are G2c, it appeared in Armenia no earlier than 802 CE and no later than the mid-14th century.
Other predicted G2c Jewish haplotypes

Two possible G2c Y-STR haplotype
Haplotype
A haplotype in genetics is a combination of alleles at adjacent locations on the chromosome that are transmitted together...

 samples in the literature are from the study of Jewish and non-Jewish Near Eastern Y chromosomes by Nebel et al. (2001) (in the Appendix Table A1), haplotype 51 which was found in 1 Ashkenazi Jew (n=79) and 3 Kurdish Jews
Kurdish Jews
Kurdish Jews or Kurdistani Jews are the ancient Eastern Jewish communities, inhabiting the region known as Kurdistan in northern Mesopotamia, roughly covering parts of Iran, northern Iraq, Syria and eastern Turkey. Their clothing and culture is similar to neighbouring Kurdish Muslims and Christian...

 (n=99), and haplotype 47 which was found in 1 Iraqi Jew (combined Iraqi Jews n=20 and Syrian Jews n=3). However, recently advancements in haplogroup prediction have determined these haplotypes G2c. These also belong to what was termed at the time "Haplogroup 2", (F*,G, and I) and within this set of haplogroups these display a Y-STR allele pattern unique to haplogroup G2c. In this study, G2c was found among 3% of Kurdish Jews.
However, as with the Armenians, there are some G2 haplotypes that appear similar to G2c at these 6 STRs, but not at DYS389.
Upcoming studies

Other Y chromosome samples taken from an upcoming study of Sephardi
Sephardi Jews
Sephardi Jews is a general term referring to the descendants of the Jews who lived in the Iberian Peninsula before their expulsion in the Spanish Inquisition. It can also refer to those who use a Sephardic style of liturgy or would otherwise define themselves in terms of the Jewish customs and...

 and Near Eastern (Mizrahi)
Mizrahi Jews
Mizrahi Jews or Mizrahiyim, , also referred to as Adot HaMizrach are Jews descended from the Jewish communities of the Middle East, North Africa and the Caucasus...

 Jews have found only a few GxG2 (in Y chromosome haplogroup G but not in G2) samples. Preliminary indications are that in this study, only a single Turkish Jew matches the any of the modal haplotypes for G2c, however, all of these samples are being tested for M377/G2c.

The Kurdish and Iraqi Jewish samples from Nebel et al. (2002) are also being tested for M377/G2c by a different group for another study. Y chromosome haplogroup G1 is also found among Jewish populations, but it is likely that some of these samples will turn out to be in haplogroup G2c.

Comparison of regional haplotypes

Population and
Location
n Status DYS393 DYS390 DYS19 DYS391 DYS385 DYS426 DYS388 DYS439 DYS392 DYS389 DYS438 DYS461
= add 2 to DYSA7.2
Ashkenazi Jews
Ashkenazi Jews
Ashkenazi Jews, also known as Ashkenazic Jews or Ashkenazim , are the Jews descended from the medieval Jewish communities along the Rhine in Germany from Alsace in the south to the Rhineland in the north. Ashkenaz is the medieval Hebrew name for this region and thus for Germany...



Poland-Lithuania

Western Germany
Germany
Germany , officially the Federal Republic of Germany , is a federal parliamentary republic in Europe. The country consists of 16 states while the capital and largest city is Berlin. Germany covers an area of 357,021 km2 and has a largely temperate seasonal climate...


Sicilians
300 confirmed 12
13
 
22
23
24
 
15
16
9
10
11
13,15
13,16
14,16
11 12  
11
12
11 13,30
13,31
13,32
13,33
14,31
14,32
14,33
15,33
10 12
Turkey
Turkey
Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...


Kars
Kars
Kars is a city in northeast Turkey and the capital of Kars Province. The population of the city is 73,826 as of 2010.-Etymology:As Chorzene, the town appears in Roman historiography as part of ancient Armenia...

1 confirmed 13 23 16 10 11 12 11 11 13,29
Pathans 1 confirmed 13 23 16 11 13,16 11 12 11 11 13,30
Pathans 6 confirmed 13 23 17 10 11 12 11 11 13,30 12
Burusho
Hunza Valley
Hunza Valley
The Hunza Valley is a mountainous valley in the Gilgit-Baltistan region of Pakistan. The Hunza valley is situated to the north of the Hunza River, at an elevation of around . The territory of Hunza is about...

1 confirmed 13 23 17 11 11 12 11 11 13,30 12
Greek
Greeks
The Greeks, also known as the Hellenes , are a nation and ethnic group native to Greece, Cyprus and neighboring regions. They also form a significant diaspora, with Greek communities established around the world....


Athens
Athens
Athens , is the capital and largest city of Greece. Athens dominates the Attica region and is one of the world's oldest cities, as its recorded history spans around 3,400 years. Classical Athens was a powerful city-state...

1 unlikely 13 23 16 11 13,16 11 13,31
Syrians
Demographics of Syria
Syrians today are an overall indigenous Levantine people. While modern-day Syrians are commonly described as Arabs by virtue of their modern-day language and bonds to Arab culture and history...

2 unlikely 13 23 16 11 14,16
14,15
11 13,30
Iranian
Demographics of Iran
Iran's population increased dramatically during the later half of the 20th century, reaching about 75 million by 2011. In recent years, however, Iran's birth rate has dropped significantly. Studies project that Iran's rate of population growth will continue to slow until it stabilizes above 100...


Tehran
Tehran
Tehran , sometimes spelled Teheran, is the capital of Iran and Tehran Province. With an estimated population of 8,429,807; it is also Iran's largest urban area and city, one of the largest cities in Western Asia, and is the world's 19th largest city.In the 20th century, Tehran was subject to...

1 unlikely 13 23 17 10 13,16 11 13,29
Iraqi Jew 1 predicted G2c 13 23 15 11 11 12 11
Armenians
Armenians
Armenian people or Armenians are a nation and ethnic group native to the Armenian Highland.The largest concentration is in Armenia having a nearly-homogeneous population with 97.9% or 3,145,354 being ethnic Armenian....


The Ani
Ani
Ani is a ruined and uninhabited medieval Armenian city-site situated in the Turkish province of Kars, near the border with Armenia. It was once the capital of a medieval Armenian kingdom that covered much of present day Armenia and eastern Turkey...

 region
Nagorno-Karabakh
Nagorno-Karabakh
Nagorno-Karabakh is a landlocked region in the South Caucasus, lying between Lower Karabakh and Zangezur and covering the southeastern range of the Lesser Caucasus mountains...

5 predicted G2c 13 23 15 10 11 12 11
Kurdish Jews
Kurdish Jews
Kurdish Jews or Kurdistani Jews are the ancient Eastern Jewish communities, inhabiting the region known as Kurdistan in northern Mesopotamia, roughly covering parts of Iran, northern Iraq, Syria and eastern Turkey. Their clothing and culture is similar to neighbouring Kurdish Muslims and Christian...

3 predicted G2c 13 23 15 10 11 12 11

Time to the Most Recent Common Ancestor (tMRCA)

The time to the Most Recent Common Ancestor (tMRCA) for European G2c, derived by generating a median-joining network of over 25 haplotypes with 67 Y-STRs, yields a date of 955 years from the average birth year of the testees (estimated to be 1950), with a standard deviation of 107 years. The mutation rate used is based on that of family groups with known most recent common ancestors. So far, this tMRCA includes all groups of European G2cs, including it seems from preliminary evidence, the Italians.

This late tMRCA date for all of G2c in Europe raises the question of when G2c first entered Europe. If G2c entered Europe at an earlier period, we would expect to see more divergent haplotypes than we currently see. The very unusual highly ethnically-specific distribution of G2c in Europe combined with the very late tMRCA raises the question of from where G2c could have entered Europe.
Also, was the spread of G2c in Europe from the Kingdom of Poland to Germany and Italy, from German to Italy and Poland, or Italy northward to both other areas? No one particular region seems to be more divergent than any other, and in fact, there doesn't seem to be any geographically correlated subclades within European G2c, with samples from each region matching some from other regions more closely than ones from the same region.

Sicily

It is estimated that Jews made up 6% or more of the population of Sicily in 1492. Historical evidence shows that most Sicilian Jews went eastward to the Ottoman Empire, where Sicilian Jewish congregations existed in Salonika and Constantinople
Constantinople
Constantinople was the capital of the Roman, Eastern Roman, Byzantine, Latin, and Ottoman Empires. Throughout most of the Middle Ages, Constantinople was Europe's largest and wealthiest city.-Names:...

 until the late 19th century. However, it is known that many Sicilian Jews first went to Calabria
Calabria
Calabria , in antiquity known as Bruttium, is a region in southern Italy, south of Naples, located at the "toe" of the Italian Peninsula. The capital city of Calabria is Catanzaro....

, and then Jews were expelled from Calabria in 1524, and later from the entire Kingdom of Naples in 1540. Thre was a gradual movement throughout the 16th century of Jews in Italy from south to north, with conditions worsening for Jews in Rome after 1556 and Venice in the 1580s. Many Jews from Venice and the surrounding area migrated to Poland and Lithuania at this time.

In this scenario it may be that there was a direct migration from Sicily or Southern Italy separately to both Western Germany and Poland-Lithuania, but the presence of G2c in Germany may be due to a later migration from Eastern Europe to Germany starting with the aftermath of Khmelnytsky's Pogrom
Khmelnytsky Uprising
The Khmelnytsky Uprising, was a Cossack rebellion in the Ukraine between the years 1648–1657 which turned into a Ukrainian war of liberation from Poland...

 in Poland in 1648,

Jews had lived in Sicily since Roman times. After the Byzantine reconquest of Sicily from the Arian
Arianism
Arianism is the theological teaching attributed to Arius , a Christian presbyter from Alexandria, Egypt, concerning the relationship of the entities of the Trinity and the precise nature of the Son of God as being a subordinate entity to God the Father...

 Ostrogoths who were very tolerant of the Jews in 552, conditions worsened dramatically for Jews in Sicily. Under the Byzantine Empire
Byzantine Empire
The Byzantine Empire was the Eastern Roman Empire during the periods of Late Antiquity and the Middle Ages, centred on the capital of Constantinople. Known simply as the Roman Empire or Romania to its inhabitants and neighbours, the Empire was the direct continuation of the Ancient Roman State...

 few Jews lived in Sicily because of official persecution. Before 606 the bishop of Palermo ordered the synagogue to be converted into a church. An edict issued by Leo III the Isaurian in 722 which ordered the baptism by force of all Jews in the Empire. After the Muslim conquest of Sicily in 831-902, large numbers of Jews settled on the island. In 972, the Arab merchant Ibn Hawqal mentioned a Jewish Quarter in Palermo, and by 1170, Benjamin of Tudela reported 1500 Jewish households in Palermo and 200 in Messina. In 1149, Roger II forcibly brought the Jewish brocade, damask, and silk weavers of Thebes in Greece to Sicily to establish a silk industry there. This is an example of a late entry into Sicily of non-Iberian, non-Provençal Jews from outside of Western and Central Europe, from a region that has been poorly tested or devoid of Jews in modern times.

The preliminary conclusions from this evidence is that haplogroup G2c is not native to Europe. The very late tMRCA, and the very high ethnic specificity indicate a rather brief presence in Europe, but one that participated in the exponential growth of the Ashkenazi Jewish population in Eastern and Central Europe after the Black Death. The complete lack of G2c in Iberia and also so far among Spanish Jews indicates that G2c didn't come from Spain, or France, since some Spanish Jewish families originated in southern France and migrated to Spain after France expelled the Jews in 1306. This, along with the other evidence, leaves Sicily as the European origin of G2c. We know that Greek and Mizrahi Jews
Mizrahi Jews
Mizrahi Jews or Mizrahiyim, , also referred to as Adot HaMizrach are Jews descended from the Jewish communities of the Middle East, North Africa and the Caucasus...

 arrived in Sicily as late as 1149,and that primarily most Sicilian Jews settled there during the Arab Emirate of Sicily
Emirate of Sicily
The Emirate of Sicily was an Islamic state on the island of Sicily , which existed from 965 to 1072.-First Arab invasions of Sicily:...

. This is one way of explaining the very late presence of G2c in Europe, the likely presence of G2c among at least Kurdish Jews
Kurdish Jews
Kurdish Jews or Kurdistani Jews are the ancient Eastern Jewish communities, inhabiting the region known as Kurdistan in northern Mesopotamia, roughly covering parts of Iran, northern Iraq, Syria and eastern Turkey. Their clothing and culture is similar to neighbouring Kurdish Muslims and Christian...

, if not other Mizrahi Jews
Mizrahi Jews
Mizrahi Jews or Mizrahiyim, , also referred to as Adot HaMizrach are Jews descended from the Jewish communities of the Middle East, North Africa and the Caucasus...

 as well.

The East - the Pathans and the Burushos

The presence of G2c in the these areas may be accounted for by several several separate theories, each with their own time scale. It does seem very likely that G2c originated in the Near East, in Anatolia
Anatolia
Anatolia is a geographic and historical term denoting the westernmost protrusion of Asia, comprising the majority of the Republic of Turkey...

 or Syria
Syria
Syria , officially the Syrian Arab Republic , is a country in Western Asia, bordering Lebanon and the Mediterranean Sea to the West, Turkey to the north, Iraq to the east, Jordan to the south, and Israel to the southwest....

, and spread both eastward and westward from there.

One often stated idea is of a direct Israelite
Israelite
According to the Bible the Israelites were a Hebrew-speaking people of the Ancient Near East who inhabited the Land of Canaan during the monarchic period .The word "Israelite" derives from the Biblical Hebrew ישראל...

 ancestry for the Pashtuns as a whole. The Israelite origin of all the Pashtuns
Theory of Pashtun descent from Israelites
The theory that the Pashtun people originate from the exiled Lost Tribes of Israel was first debated by Western historians after the 19th century...

 is contradicted by the ancient sources, and also by the Iranian
Iranian languages
The Iranian languages form a subfamily of the Indo-Iranian languages which in turn is a subgroup of Indo-European language family. They have been and are spoken by Iranian peoples....

 linguistic affiliations of the Pashto language
Pashto language
Pashto , known as Afghani in Persian and Pathani in Punjabi , is the native language of the indigenous Pashtun people or Afghan people who are found primarily between an area south of the Amu Darya in Afghanistan and...

. These stories were disseminated in Medieval times for religious reasons, and as part of the competition between the Mughals and the Pashtuns. However, this does not negate a possible Medieval Jewish origin for some of the Pashtun sub-tribes
Pashtun tribes
The Pashtun people are the largest ethnic group in Afghanistan and the second largest in Pakistan. Pashtun, tribes are divided into four supertribal confederacies: the Arbanee , Betanee , Gharghasht, and Karlanee .Traditionally, according to folklore, all Pashtuns are said to have descended, at...

, but this would depend on the frequency of G2c among the Pashtuns, since any Jewish genetic admixture in relatively recent times would have been limited in scope.

The Silk Road

The rarity of G2c in northeast Pakistan could indicate that G2c in this area originates outside the region and was brought there in the historic period from further west (this area was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). These two reported G2c haplotypes seem to be quite divergent from both the Ashkenazi Jewish clade and the lone northeastern Anatolian G2c based on only 10 Y-STRs, and therefore may not indicate a recent common origin. Another possible route which brought G2c to this region is through trade, because Hunza is a fertile valley that was a major stopping point along the southern Silk Road just before the Khunjerab Pass into China.

A Northern Near Eastern / South Caucasian origin for G2c is much more likely. The Turkish G2c haplotype, and 5 of 6 other almost certain G2c Armenian haplotypes have ancestors from a small region in Kars Province
Kars Province
Kars Province is a province of Turkey, located in the northeastern part of the country. It shares part of its border with the Republic of Armenia.The provinces of Ardahan and Iğdır were until the 1990s part of Kars Province.-History:...

 of Turkey near the Medieval capitals of Armenia. The rarity of G2c, which is limited to this small area which only became important after the year 884
884
Year 884 was a leap year starting on Wednesday of the Julian calendar.- Europe :* March 1 – Diego Rodríguez Porcelos founds and repopulates Burgos....

 is most likely due to G2c arriving in the region after this time.

Again, the Jewish areas of Kurdistan were not far from this same region. Haplogroup G
Haplogroup G (Y-DNA)
In human genetics, Haplogroup G is a Y-chromosome haplogroup. It is a branch of Haplogroup F . Haplogroup G has an overall low frequency in most populations but is widely distributed within many ethnic groups of the Old World in Europe, northern and western Asia, northern Africa, the Middle East,...

 has its greatest diversity in this same area, where all recorded sub-haplogroups of G have been found, so the evidence seems to point to this region of Eastern Anatolia or south of the Caucasus as the area of origin for all of haplogroup G as well. G2c could have spread from this region eastward toward the Hindu Kush and the Karakorum ranges, and southward among the Judeans, and then subsequently westward with the Jewish Diaspora
Jewish diaspora
The Jewish diaspora is the English term used to describe the Galut גלות , or 'exile', of the Jews from the region of the Kingdom of Judah and Roman Iudaea and later emigration from wider Eretz Israel....

 to Italy and then Central and Eastern Europe. If the evidence shows that no Sephardi or Mizrahi Jews have G2c, then an origin with the Khazars
Khazars
The Khazars were semi-nomadic Turkic people who established one of the largest polities of medieval Eurasia, with the capital of Atil and territory comprising much of modern-day European Russia, western Kazakhstan, eastern Ukraine, Azerbaijan, large portions of the northern Caucasus , parts of...

 of the Caucasus or another associated people who historically converted to Judaism during the Khazar Empire (c. 670-1017) although the particular regions where G2c is found in northeastern Anatolia and Armenia were never part of the Khazar Empire even at its greatest extent but always a part of Armenia.

Further avenues for research

More samples from Italy
Italy
Italy , officially the Italian Republic languages]] under the European Charter for Regional or Minority Languages. In each of these, Italy's official name is as follows:;;;;;;;;), is a unitary parliamentary republic in South-Central Europe. To the north it borders France, Switzerland, Austria and...

 are very important. Also, deriving a tMRCA for all of European G2c, including Italy is crucial. One would expect that the tMRCA including Italy would be a bit further back than circa 1492, but so far there is no evidence for this. Confirming whether there are other Jewish G2c's that are not European, and then getting the tMRCA with these samples will indicate the immediate source of Ashkenazi Jewish G2c. Confirmation that the Armenian haplotypes are actually G2c is also needed. Then, finding more G2c's in the Kashmir region and calculating a tMRCA, with the Turkish G2c sample and the Jewish G2c's, would indicate the direction of the gene flow.

Famous people in haplogroup G2c

  • John G. Cramer
    John G. Cramer
    John G. Cramer is a professor of physics at the University of Washington in Seattle, the United States. When not teaching, he works with the STAR detector at the new Relativistic Heavy Ion Collider at Brookhaven National Laboratory, and the particle accelerator at CERN in Geneva, Switzerland...

     (b. 1934)
Physicist and author.
  • James Franciscus
    James Franciscus
    James Grover Franciscus was an American actor, known for his roles in the series The Naked City and The Investigators, and in feature films.-Life and career:...

     (1934–1991)
Leading American film and television actor.
  • Newton Minow (b. 1926)
Former Chairman of the United States Federal Communications Commission
Federal Communications Commission
The Federal Communications Commission is an independent agency of the United States government, created, Congressional statute , and with the majority of its commissioners appointed by the current President. The FCC works towards six goals in the areas of broadband, competition, the spectrum, the...

 (FCC) and Chairman of the Public Broadcasting Service
Public Broadcasting Service
The Public Broadcasting Service is an American non-profit public broadcasting television network with 354 member TV stations in the United States which hold collective ownership. Its headquarters is in Arlington, Virginia....

 (PBS).

See also

  • Haplogroup G (Y-DNA)
    Haplogroup G (Y-DNA)
    In human genetics, Haplogroup G is a Y-chromosome haplogroup. It is a branch of Haplogroup F . Haplogroup G has an overall low frequency in most populations but is widely distributed within many ethnic groups of the Old World in Europe, northern and western Asia, northern Africa, the Middle East,...

  • Haplogroup G (Y-DNA) Country by Country
    Haplogroup G (Y-DNA) Country by Country
    In human genetics, Haplogroup G is a Y-chromosome haplogroupNone of the sampling done by research studies shown here would qualify as true random sampling, and thus any percentages of haplogroup G provided country by country are only rough approximations of what would be found in the full population...

  • haplotype
    Haplotype
    A haplotype in genetics is a combination of alleles at adjacent locations on the chromosome that are transmitted together...

  • Y-STR
    Y-STR
    A Y-STR is a short tandem repeat on the Y-chromosome. Y-STRs are often used in forensics, paternity, and genealogical DNA testing.-Nomenclature:Y-STRs are assigned names by the HUGO gene nomenclature committee....

  • archaeogenetics
    Archaeogenetics
    Archaeogenetics, a term coined by Colin Renfrew, refers to the application of the techniques of molecular population genetics to the study of the human past. This can involve:*the analysis of DNA recovered from archaeological remains, i.e...

  • genetic genealogy
    Genetic genealogy
    Genetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy involves the use of genealogical DNA testing to determine the level of genetic relationship between individuals.-History:...


Sites


Maps


Mailing Lists

The source of this article is wikipedia, the free encyclopedia.  The text of this article is licensed under the GFDL.
 
x
OK