Haplogroup G1 (Y-DNA)
Encyclopedia
In human genetics
, Haplogroup G1 (M285) is a Y-chromosome haplogroup
. G1 is a branch of Haplogroup G Y-DNA (M201). Haplogroup G1 has an extremely low frequency in almost all countries except Iran
and the countries adjoining Iran on the west.
(STR) marker DYS392 and all will have the M285 SNP mutation which characterizes this group. This value of 12 is also uncommon in other haplogroups. The M designation for M285 indicates it was first identified at Stanford University
.
M285 has the following characteristics: The reference ID number is rs13447378.....Y position is 21151128....The forward primer sequence is ttatcctgagccgttgtccctg and the reverse sequence tgtagagacacggttgtaccct....The mutation is G to C. M285 was first reported in 2004 by Cinnioglu et al.
So far all persons tested who have the M285 mutation also are positive the M342 SNP mutation. If someone should test differently, his results would become the basis of a new G1 category. M342 is located at sequence position 21653330 and is AGAGAGTTTTCTAACAGGGCG in the forward primer and TGGGAATCACTTTTGCAACT in the reverse. It is a mutation from C to T. M342 was also identified at Stanford University,
In addition, within haplogroup G, those G1 persons tested so far are uniquely positive (derived) for SNP L89 while all other G persons are negative (ancestral). The L89 SNP mutation has also been found in other haplogroups. L89 is located at sequence position 8038725, and the reference ID number is rs35160044. It is a mutation from T to C. The L89 designation was provided by Family Tree DNA.
, with next most frequent concentrations in neighboring countries to the west. Specifically G1 was found in 5% of 177 samples from southern Iran in one study. The same study found G1 in 3% of 33 samples in northern Iran. The percentage in the south was almost equal to the percentage of G2, the only region in the world where G2 types were not found to be heavily dominant. Earlier studies which found about the same percentages of G in various parts of Iran failed to test specifically for G1.
In Turkey
, Cinnioglu found 1% of 523 samples of all types belonging to haplogroup G1 and like all available G1 outside Iran G1 was overshadowed by a much larger number of G2 men in the sample. All but one of the G1 samples in this study belonged to the further subgroup G1a, and all the samples were from northeastern Turkey.
A study of Lebanon
by Zalloua et al. failed to test for G1, but 26% of 38 G samples had the value of 12 for STR marker DYS392, almost always characteristic of G1. These G1 samples represent only 2% of the 587 total Lebanese samples and were well distributed among all religious groups there.
A study of the Levant
by El-Sibai et al. also failed to test for G1, but 12% of 17 Syrian G samples had the 12 value at DYS392. These G1 samples represent less than 1% of 354 Syrian samples. In the same study, 21% of 14 Jordanian G samples had the 12 value. These G1 samples represent 1% of 274 Jordanian samples. None of 8 Egyptian G samples had the 12 value.
The likely G samples in the YHRD database from the southern Caucasus area (Azerbaijan
, Georgia
, Armenia
, Abazinia
, Abhazia) and from the northern Caucasus (North Ossetians, Kabardinians, Ingushians, Darginians, Lezginians, Rutulians and Chechnians) have only several 12-value DYS392 samples that might be G1.
While most research studies have failed to test for G1, likely or proven G1 STR marker samples in very small numbers are available from (a) Nepal
, India
and Sri Lanka
in south Asia, (b) Iran
, Russia
, Pakistan
and Kazakhstan
in southwestern Asia, (c) Greece
, Turkey
, Iraq
, Dubai
, Palestine
, Jordan
, Saudi Arabia
and Yemen
in the eastern Mediterranean and the Middle East
, and (d) almost all countries of Europe
.
where G1 persons comprised 87% of 45 samples.
and first reported by the Y Chromosome Consortium in 2002. Category G1a has a separate subgroup based on the presence of the value of 8 at STR
marker DYS494. With the exception of this G1a subgroup, all other G persons have 9 at this slowly mutating marker. So far about half of G1a persons who are otherwise ungrouped have this 8 value.
G1a1 (L201, L202 and L203) were identified in a G1a person tested at Family Tree DNA in fall 2009, Subsequent testing showed that only some G1a persons have these mutations, and so far they are all from a closely related Ashkenazi Jewish cluster of men. The following Y positions were noted: 2718285 for L201, 13001714 for L202 and 13001715 for L203. In L201 the mutation is C to T; in L202 from T to C; and in L203 from A to G. If any man should have one of these SNP mutations without the others, this information would become the basis of a new G1a1 classification.
G1b (P76) was identified in a person in Sri Lanka
and so far has not shown up among samples in more northern nations. The technical features of P76 are: Y position is 20340415....forward primer is gaagcaatactctgaaaagt.....reverse primer is tttggagggacattattctc...the mutation is from G to C. This information was first reported by Karafet et al. in 2008. This mutation was first identified at the University of Arizona
.
.
Among available 67-marker G1 STR samples, the Ashkenazi G1a1 Jewish cluster represents the closest relatives to the Kazakh G1a cluster. The common ancestor of the two clusters, however, probably lived over 3,000 years ago.
The Ashkenazi G1 cluster is only distantly related to the Ashkenazi G1a1 cluster, and the G1 Ashkenazi cluster has nearest relatives instead among diverse Europeans.
Human genetics
Human genetics describes the study of inheritance as it occurs in human beings. Human genetics encompasses a variety of overlapping fields including: classical genetics, cytogenetics, molecular genetics, biochemical genetics, genomics, population genetics, developmental genetics, clinical genetics,...
, Haplogroup G1 (M285) is a Y-chromosome haplogroup
Haplogroup
In the study of molecular evolution, a haplogroup is a group of similar haplotypes that share a common ancestor having the same single nucleotide polymorphism mutation in both haplotypes. Because a haplogroup consists of similar haplotypes, this is what makes it possible to predict a haplogroup...
. G1 is a branch of Haplogroup G Y-DNA (M201). Haplogroup G1 has an extremely low frequency in almost all countries except Iran
Iran
Iran , officially the Islamic Republic of Iran , is a country in Southern and Western Asia. The name "Iran" has been in use natively since the Sassanian era and came into use internationally in 1935, before which the country was known to the Western world as Persia...
and the countries adjoining Iran on the west.
Genetic Features
Almost all G1 persons have the value of 12 at short tandem repeatShort tandem repeat
A short tandem repeat in DNA occurs when a pattern of two or more nucleotides are repeated and the repeated sequences are directly adjacent to each other. The pattern can range in length from 2 to 5 base pairs and is typically in the non-coding intron region...
(STR) marker DYS392 and all will have the M285 SNP mutation which characterizes this group. This value of 12 is also uncommon in other haplogroups. The M designation for M285 indicates it was first identified at Stanford University
Stanford University
The Leland Stanford Junior University, commonly referred to as Stanford University or Stanford, is a private research university on an campus located near Palo Alto, California. It is situated in the northwestern Santa Clara Valley on the San Francisco Peninsula, approximately northwest of San...
.
M285 has the following characteristics: The reference ID number is rs13447378.....Y position is 21151128....The forward primer sequence is ttatcctgagccgttgtccctg and the reverse sequence tgtagagacacggttgtaccct....The mutation is G to C. M285 was first reported in 2004 by Cinnioglu et al.
So far all persons tested who have the M285 mutation also are positive the M342 SNP mutation. If someone should test differently, his results would become the basis of a new G1 category. M342 is located at sequence position 21653330 and is AGAGAGTTTTCTAACAGGGCG in the forward primer and TGGGAATCACTTTTGCAACT in the reverse. It is a mutation from C to T. M342 was also identified at Stanford University,
In addition, within haplogroup G, those G1 persons tested so far are uniquely positive (derived) for SNP L89 while all other G persons are negative (ancestral). The L89 SNP mutation has also been found in other haplogroups. L89 is located at sequence position 8038725, and the reference ID number is rs35160044. It is a mutation from T to C. The L89 designation was provided by Family Tree DNA.
Dating of G1 Origin
While research studies have not yet dated the origin of G1's M285 SNP mutation, it seemingly represents one of the older G groups, arising perhaps halfway between the origin of G and the present day based on the number of STR marker mutations.Country by Country
The highest reported concentration of G1 and its subgroups in a single country is in IranIran
Iran , officially the Islamic Republic of Iran , is a country in Southern and Western Asia. The name "Iran" has been in use natively since the Sassanian era and came into use internationally in 1935, before which the country was known to the Western world as Persia...
, with next most frequent concentrations in neighboring countries to the west. Specifically G1 was found in 5% of 177 samples from southern Iran in one study. The same study found G1 in 3% of 33 samples in northern Iran. The percentage in the south was almost equal to the percentage of G2, the only region in the world where G2 types were not found to be heavily dominant. Earlier studies which found about the same percentages of G in various parts of Iran failed to test specifically for G1.
In Turkey
Turkey
Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...
, Cinnioglu found 1% of 523 samples of all types belonging to haplogroup G1 and like all available G1 outside Iran G1 was overshadowed by a much larger number of G2 men in the sample. All but one of the G1 samples in this study belonged to the further subgroup G1a, and all the samples were from northeastern Turkey.
A study of Lebanon
Lebanon
Lebanon , officially the Republic of LebanonRepublic of Lebanon is the most common term used by Lebanese government agencies. The term Lebanese Republic, a literal translation of the official Arabic and French names that is not used in today's world. Arabic is the most common language spoken among...
by Zalloua et al. failed to test for G1, but 26% of 38 G samples had the value of 12 for STR marker DYS392, almost always characteristic of G1. These G1 samples represent only 2% of the 587 total Lebanese samples and were well distributed among all religious groups there.
A study of the Levant
Levant
The Levant or ) is the geographic region and culture zone of the "eastern Mediterranean littoral between Anatolia and Egypt" . The Levant includes most of modern Lebanon, Syria, Jordan, Israel, the Palestinian territories, and sometimes parts of Turkey and Iraq, and corresponds roughly to the...
by El-Sibai et al. also failed to test for G1, but 12% of 17 Syrian G samples had the 12 value at DYS392. These G1 samples represent less than 1% of 354 Syrian samples. In the same study, 21% of 14 Jordanian G samples had the 12 value. These G1 samples represent 1% of 274 Jordanian samples. None of 8 Egyptian G samples had the 12 value.
The likely G samples in the YHRD database from the southern Caucasus area (Azerbaijan
Azerbaijan
Azerbaijan , officially the Republic of Azerbaijan is the largest country in the Caucasus region of Eurasia. Located at the crossroads of Western Asia and Eastern Europe, it is bounded by the Caspian Sea to the east, Russia to the north, Georgia to the northwest, Armenia to the west, and Iran to...
, Georgia
Georgia (country)
Georgia is a sovereign state in the Caucasus region of Eurasia. Located at the crossroads of Western Asia and Eastern Europe, it is bounded to the west by the Black Sea, to the north by Russia, to the southwest by Turkey, to the south by Armenia, and to the southeast by Azerbaijan. The capital of...
, Armenia
Armenia
Armenia , officially the Republic of Armenia , is a landlocked mountainous country in the Caucasus region of Eurasia...
, Abazinia
Abazinia
Abazinia, Abazashta or Abaza is a historical country at the northern mountainside of the Caucasus Major, now the northern part of Karachay-Cherkessian Republic, Russia. Abazinia is a home of the Abazins, a people related to the Abkhaz people and speaking the Abazin language.Abazinia once was a part...
, Abhazia) and from the northern Caucasus (North Ossetians, Kabardinians, Ingushians, Darginians, Lezginians, Rutulians and Chechnians) have only several 12-value DYS392 samples that might be G1.
While most research studies have failed to test for G1, likely or proven G1 STR marker samples in very small numbers are available from (a) Nepal
Nepal
Nepal , officially the Federal Democratic Republic of Nepal, is a landlocked sovereign state located in South Asia. It is located in the Himalayas and bordered to the north by the People's Republic of China, and to the south, east, and west by the Republic of India...
, India
India
India , officially the Republic of India , is a country in South Asia. It is the seventh-largest country by geographical area, the second-most populous country with over 1.2 billion people, and the most populous democracy in the world...
and Sri Lanka
Sri Lanka
Sri Lanka, officially the Democratic Socialist Republic of Sri Lanka is a country off the southern coast of the Indian subcontinent. Known until 1972 as Ceylon , Sri Lanka is an island surrounded by the Indian Ocean, the Gulf of Mannar and the Palk Strait, and lies in the vicinity of India and the...
in south Asia, (b) Iran
Iran
Iran , officially the Islamic Republic of Iran , is a country in Southern and Western Asia. The name "Iran" has been in use natively since the Sassanian era and came into use internationally in 1935, before which the country was known to the Western world as Persia...
, Russia
Russia
Russia or , officially known as both Russia and the Russian Federation , is a country in northern Eurasia. It is a federal semi-presidential republic, comprising 83 federal subjects...
, Pakistan
Pakistan
Pakistan , officially the Islamic Republic of Pakistan is a sovereign state in South Asia. It has a coastline along the Arabian Sea and the Gulf of Oman in the south and is bordered by Afghanistan and Iran in the west, India in the east and China in the far northeast. In the north, Tajikistan...
and Kazakhstan
Kazakhstan
Kazakhstan , officially the Republic of Kazakhstan, is a transcontinental country in Central Asia and Eastern Europe. Ranked as the ninth largest country in the world, it is also the world's largest landlocked country; its territory of is greater than Western Europe...
in southwestern Asia, (c) Greece
Greece
Greece , officially the Hellenic Republic , and historically Hellas or the Republic of Greece in English, is a country in southeastern Europe....
, Turkey
Turkey
Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...
, Iraq
Iraq
Iraq ; officially the Republic of Iraq is a country in Western Asia spanning most of the northwestern end of the Zagros mountain range, the eastern part of the Syrian Desert and the northern part of the Arabian Desert....
, Dubai
Dubai
Dubai is a city and emirate in the United Arab Emirates . The emirate is located south of the Persian Gulf on the Arabian Peninsula and has the largest population with the second-largest land territory by area of all the emirates, after Abu Dhabi...
, Palestine
Palestine
Palestine is a conventional name, among others, used to describe the geographic region between the Mediterranean Sea and the Jordan River, and various adjoining lands....
, Jordan
Jordan
Jordan , officially the Hashemite Kingdom of Jordan , Al-Mamlaka al-Urduniyya al-Hashemiyya) is a kingdom on the East Bank of the River Jordan. The country borders Saudi Arabia to the east and south-east, Iraq to the north-east, Syria to the north and the West Bank and Israel to the west, sharing...
, Saudi Arabia
Saudi Arabia
The Kingdom of Saudi Arabia , commonly known in British English as Saudi Arabia and in Arabic as as-Sa‘ūdiyyah , is the largest state in Western Asia by land area, constituting the bulk of the Arabian Peninsula, and the second-largest in the Arab World...
and Yemen
Yemen
The Republic of Yemen , commonly known as Yemen , is a country located in the Middle East, occupying the southwestern to southern end of the Arabian Peninsula. It is bordered by Saudi Arabia to the north, the Red Sea to the west, and Oman to the east....
in the eastern Mediterranean and the Middle East
Middle East
The Middle East is a region that encompasses Western Asia and Northern Africa. It is often used as a synonym for Near East, in opposition to Far East...
, and (d) almost all countries of Europe
Europe
Europe is, by convention, one of the world's seven continents. Comprising the westernmost peninsula of Eurasia, Europe is generally 'divided' from Asia to its east by the watershed divides of the Ural and Caucasus Mountains, the Ural River, the Caspian and Black Seas, and the waterways connecting...
.
Sites with G1 Concentrations
The highest concentration of G1 within a distinct group within a country was reported among the Madjars of KazakhstanKazakhstan
Kazakhstan , officially the Republic of Kazakhstan, is a transcontinental country in Central Asia and Eastern Europe. Ranked as the ninth largest country in the world, it is also the world's largest landlocked country; its territory of is greater than Western Europe...
where G1 persons comprised 87% of 45 samples.
SNP-defined Subgroups
Subgroup G1a (P20) is rather common among G1 persons, but the reliability of SNP P20 in identifying G1a persons makes some tests for P20 a problem. P20 results may be reported as P20.1, P20.2 and P20.3, and persons may have varying results for each. The technical features of P20 are: Y position is 25029911; 23396163.....forward primer is tggatctgattcacaggtag.....reverse primer is ccaacaatatgtcacaatctc...the mutation is a deletion of C. The mutation was identified at the University of ArizonaUniversity of Arizona
The University of Arizona is a land-grant and space-grant public institution of higher education and research located in Tucson, Arizona, United States. The University of Arizona was the first university in the state of Arizona, founded in 1885...
and first reported by the Y Chromosome Consortium in 2002. Category G1a has a separate subgroup based on the presence of the value of 8 at STR
STR
STR, StR, Str or str may stand for:*Short tandem repeat, in DNA testing*Special Theory of Relativity, Einstein's theory*S. T...
marker DYS494. With the exception of this G1a subgroup, all other G persons have 9 at this slowly mutating marker. So far about half of G1a persons who are otherwise ungrouped have this 8 value.
G1a1 (L201, L202 and L203) were identified in a G1a person tested at Family Tree DNA in fall 2009, Subsequent testing showed that only some G1a persons have these mutations, and so far they are all from a closely related Ashkenazi Jewish cluster of men. The following Y positions were noted: 2718285 for L201, 13001714 for L202 and 13001715 for L203. In L201 the mutation is C to T; in L202 from T to C; and in L203 from A to G. If any man should have one of these SNP mutations without the others, this information would become the basis of a new G1a1 classification.
G1b (P76) was identified in a person in Sri Lanka
Sri Lanka
Sri Lanka, officially the Democratic Socialist Republic of Sri Lanka is a country off the southern coast of the Indian subcontinent. Known until 1972 as Ceylon , Sri Lanka is an island surrounded by the Indian Ocean, the Gulf of Mannar and the Palk Strait, and lies in the vicinity of India and the...
and so far has not shown up among samples in more northern nations. The technical features of P76 are: Y position is 20340415....forward primer is gaagcaatactctgaaaagt.....reverse primer is tttggagggacattattctc...the mutation is from G to C. This information was first reported by Karafet et al. in 2008. This mutation was first identified at the University of Arizona
University of Arizona
The University of Arizona is a land-grant and space-grant public institution of higher education and research located in Tucson, Arizona, United States. The University of Arizona was the first university in the state of Arizona, founded in 1885...
.
STR Marker Value Clusters
There exist two distinctive European-ancestry Ashkenazi Jewish clusterings of G1 men (G1 and G1a1) ans a distinctive G1a Kazakh cluster—all three based on STR marker values. Men in the Jewish G1 cluster have a value of 12 at STR marker DYS446 which is several values lower than almost all G persons, but the other two groups lack one specific marker value as an identifier. When approximately 30 or more STR markers are available when comparing samples, members in each of the three groups in easily ascertained. One of the distinctive European-ancestry G1 Ashkenazi Jewish STR marker value combinations is found also in an Iraqi Jew in one research study. See also page covering Jews with Haplogroup G (Y-DNA)Jews with Haplogroup G (Y-DNA)
There are significant numbers of Jewish men found within multiple subgroups of haplogroup G . Haplogroup G is found in significantly different percentages within the various Jewish ethnic divisions, ranging from about a third of Moroccan Jews to almost none reported among the Indian, Yemenite and...
.
Among available 67-marker G1 STR samples, the Ashkenazi G1a1 Jewish cluster represents the closest relatives to the Kazakh G1a cluster. The common ancestor of the two clusters, however, probably lived over 3,000 years ago.
The Ashkenazi G1 cluster is only distantly related to the Ashkenazi G1a1 cluster, and the G1 Ashkenazi cluster has nearest relatives instead among diverse Europeans.
Migrations of G1 Persons
The concentration of G1 found today in Iran and adjoining territory to its west suggests, but does not prove, this same area was the site of G1 origin. Due to the lengthy age of G1, distant migrations of small numbers of G1 persons could have occurred at anytime during the historical period through a variety of types of population movements. It would be speculative to assume how the Ashkenazi G1 clusters or the Kazakh G1 clusters of men arrived in northeastern Europe and Kazakhstan respectively.See also
- genetic genealogyGenetic genealogyGenetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy involves the use of genealogical DNA testing to determine the level of genetic relationship between individuals.-History:...
- Y-DNA haplogroups by ethnic groupsY-DNA haplogroups by ethnic groupsListed here are notable ethnic groups by Y-DNA haplogroups based on relevant studies. The data is presented in two columns for each haplogroup with the first being the sample size and the second the percentage in the haplogroup designated by the column header...
- Haplogroup G (Y-DNA) Country by CountryHaplogroup G (Y-DNA) Country by CountryIn human genetics, Haplogroup G is a Y-chromosome haplogroupNone of the sampling done by research studies shown here would qualify as true random sampling, and thus any percentages of haplogroup G provided country by country are only rough approximations of what would be found in the full population...