
Haplogroup Q (Y-DNA)
Encyclopedia
In human genetics
, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.
Q is one of the two branches of haplogroup P
(M45). Haplogroup Q is believed to have arisen in Central Asia
approximately 15,000 to 20,000 years ago. It has had multiple origins proposed. Much of the conflict may be attributed to limited sample sizes and early definitions that used a combination of M242, P36.2, and MEH2 as defining mutations.
This haplogroup has many diverse haplotype
s despite its low frequency among most populations outside of the Americas. There also are over a dozen subclade
s that have been sampled and identified in modern populations.
DYS435 with a value of 12. This low frequency value has been found as a novel Q lineage (Q5) in Indian populations.
. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.
s of Haplogroup Q with their defining mutation(s), according to the 2011 ISOGG tree are provided below.
, North Africa
, East Asia
, South Asia
, West Asia, and in Europe
.
.
Approximately 20,000 to 15,000 years ago, a group migrated from Asia into the Americas
by crossing the Bering Strait
. Many of the men in this group must have belonged to haplogroup Q for it now accounts for the majority of non-European haplogroups in indigenous peoples of the Americas
.
Indeed, haplogroup Q has been found in approximately 94% of Indigenous
peoples of South America
and detected in Na-Dené speakers
at a rate of 25-50%, and North American Eskimo–Aleut populations at about 46%.
In more modern population groups from the Americas, all Q samples tested for M346 have been positive. This founding population spread throughout the Americas. In the Americas, a member of the founding population underwent a mutation, producing its descendant population defined by the M3 single nucleotide polymorphism
(SNP). Many members of haplogroup Q in the Americas
belong to the Q-M3 subclade.
However, a 4000-year-old Saqqaq
individual belonging to Q-MEH2 haplogroup has been documented.
, haplogroup Q may be found throughout Asia
. It has been reported that Q is found in the Altai people, India
, Tibet
, Pakistan
, China
, Mongolia
, Tuvans
, and Uyghurs
.
.
The frequency of Q in northern China is about 4%, with many Chinese samples of haplogroup Q belonging to the subclade Q-M120. Haplogroup Q is found in approximately 3% of males in Tibet
and Mongolia
.
It is also found in 3% of Uyghurs
.
The highest frequencies of Q in Asia are found among the Selkups (~70%) and Kets (~95%), they live in western and middle Siberia
and their populations are small in number, being just under 5,000 and 1,500, respectively.
, though in low frequency. A novel subgroup Q4 was identified recently which is also restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to the Indian subcontinent followed by an autochthonous differentiation
to Q4 and Q5 sublineages later on. Thus the subcontinent has three novel Q lineages, an ancestral Q* (different from the Central Asian Q*), Q4 and Q5 unique to the subcontinent.
In Pakistan
, at the eastern end of the Iranian plateau, the frequency of haplogroup Q is about 2.2% (14/638) or 3.4% (6/176).
Approximately 2.5% of males in Saudi Arabia
belong to haplogroup Q.
According to Behar et al. 5% of Ashkenazi males belong to haplogroup Q. This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245.
Haplogroup Q has also been found in Algeria
ns, Arabians, Syrians, Lebanese
and the United Arab Emirates
.,
and Sweden
is about 3%, while 2,5% of Slovak males are in haplogroup Q.
To the south east, approximately 2% of males in Turkey
, In a study by Gokcumen it was found that among Turks
that belong to the Afshar tribe
haplogroup Q is seen with a prevalence of 13%. Further, the Q-M25 subclade has been found in Turkey
Q-M346 is found among the Khanty
.
§ These may include members of haplogroup R2
.
Human genetics
Human genetics describes the study of inheritance as it occurs in human beings. Human genetics encompasses a variety of overlapping fields including: classical genetics, cytogenetics, molecular genetics, biochemical genetics, genomics, population genetics, developmental genetics, clinical genetics,...
, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.
Origins
HaplogroupHaplogroup
In the study of molecular evolution, a haplogroup is a group of similar haplotypes that share a common ancestor having the same single nucleotide polymorphism mutation in both haplotypes. Because a haplogroup consists of similar haplotypes, this is what makes it possible to predict a haplogroup...
Q is one of the two branches of haplogroup P
Haplogroup P (Y-DNA)
In human genetics, Haplogroup P is a Y-chromosome DNA haplogroup.This haplogroup contains the patrilineal ancestors of most Europeans and almost all of the indigenous peoples of the Americas...
(M45). Haplogroup Q is believed to have arisen in Central Asia
Central Asia
Central Asia is a core region of the Asian continent from the Caspian Sea in the west, China in the east, Afghanistan in the south, and Russia in the north...
approximately 15,000 to 20,000 years ago. It has had multiple origins proposed. Much of the conflict may be attributed to limited sample sizes and early definitions that used a combination of M242, P36.2, and MEH2 as defining mutations.
This haplogroup has many diverse haplotype
Haplotype
A haplotype in genetics is a combination of alleles at adjacent locations on the chromosome that are transmitted together...
s despite its low frequency among most populations outside of the Americas. There also are over a dozen subclade
Subclade
In genetics, subclade is a term used to describe a subgroup of a subgenus or haplogroup. It is commonly used today in describing genealogical DNA tests of human mitochondrial DNA haplogroups and human Y-chromosome DNA haplogroups....
s that have been sampled and identified in modern populations.
Technical specification of mutation
The technical details of M242 are:- Nucleotide change: C to T
- Position (base pair): 180
- Total size (base pairs): 366
- Forward 5′→ 3′: aactcttgataaaccgtgctg
- Reverse 5′→ 3′: tccaatctcaattcatgcctc
Subclades
In Y-chromosome phylogenetics, subclades are the branches of haplogroups. These subclades are also defined by single nucleotide polymorphisms (SNPs) or unique event polymorphisms (UEPs). Haplogroup Q, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.Haplogroup and Subclade Defining SNPs
| Academic Name | RS ID | Position | Change | YCC 2008 rev | ISOGG 2008 | Parent Clade | Publications | Notes |
|---|---|---|---|---|---|---|---|---|
| P48 | ||||||||
| 13006660-13006661 | –>T | Q1a4 | Q1a4 | MEH2 | This is now considered a private SNP. The positive sample from Karafet 2008 was retested at the Family Tree DNA GRC and was found to be negative. | |||
| L57 | rs34864948 | 14083496 | A/G | |||||
| P36.2 | ||||||||
| L191 | ||||||||
| 2947379 | A>del | |||||||
| {M346, L56, L57} | The L191 SNP was found while testing a sample for M346 at the Family Tree DNA GRC. This SNP may represent a native Mexican lineage. L191 may represent single family or limited population group. Additional testing and a published haplotype or haplotypes are needed. | |||||||
| L213 | rs34549365 | 8295033 | C>G | |||||
| {M346, L56, L57} | ||||||||
| L245 | ||||||||
| 5735090 | C>G | |||||||
| {M378, L214, L215} | ||||||||
| M346 | ||||||||
| 2947156 | C>G | Q1a3 | Q1a3 | MEH2 | ||||
| L215 | rs34601266 | 13399368 | C>T | |||||
| P36.2 | ||||||||
| L55 | rs35768544 | 17922729 | G>A | |||||
| {M346, L56, L57} | ||||||||
| L53 | rs34724285 | 20101684 | G>A | |||||
| {M346, L56, L57} | ||||||||
| L54 | rs34954951 | 21702170 | G>A | |||||
| {M346, L56, L57} | ||||||||
| L232 | ||||||||
| 16025489 | G>A | |||||||
| M242 | The SNP was found during WTY testing at the Family Tree DNA GRC. | |||||||
| L56 | rs34703625 | 8208869 | G>A | |||||
| P36.2 | ||||||||
| P36.2 | ||||||||
| 13006449 | G>T | Q1 | Q1 | M242 | ||||
| MEH2 | rs4252209 | 4985637 | G>T | Q1a | Q1a | P36.2 | ||
| L214 | rs34694026 | 20365995 | T>C | |||||
| P36.2 | ||||||||
| M3 | rs3894 | 17605757 | C>T | Q1a3a | Q1a3a | {L53, L54, L55} | ||
| M194 | rs2032677 | 13523944 | T>C | Q1a3a2 | Q1a3a2 | M3 | ||
| P292 | rs13447374 | 13540161 | –>G | Q1a3a3 | Q1a3a3 | M3 | ||
| P106 | ||||||||
| 13932316 | G>A | Q1a3a3 | Q1a3a3 | M3 | ||||
| M19 | rs3910 | 20192619 | T>A | Q1a3a1 | Q1a3a1 | M3 | ||
| M199 | rs2032589 | 13540505-13540504 | –>G | Q1a3a3 | Q1a3a3 | M3 | ||
| M323 | rs13447377 | 20327106 | C>T | Q1a6 | Q1a6 | M346 | ||
| P89.1 | ||||||||
| 13359859 | G>T | Q1a5 | Q1a5 | MEH2 | Limited research indicates that this may be a private SNP. The P89 mutation is also found in R1b. | |||
| M265, N14 | rs3212294 | 13540044 | C>A | Q1a1 | Q1a1 | MEH2 | ||
| M242 | rs8179021 | 13527976 | C>T | Q | Q | P SNPs | ||
| M378 | ||||||||
| 13536901 | A>G | Q1b | Q1b | P36.2 | ||||
| M25 | ||||||||
| 20326052 | G>C | Q1a2 | Q1a2 | P36.2 | ||||
| M143 | ||||||||
| 20349206 | G>T | Q1a2 | Q1a2 | P36.2 | ||||
| M120 | ||||||||
| 20366782 | T>C | Q1a1 | Q1a1 | P36.2 |
Phylogenetic naming variations
The subclade proposed by Sharma 2007 (SS4bp, rs41352448) is not represented in any current trees because it is a value for the STRShort tandem repeat
A short tandem repeat in DNA occurs when a pattern of two or more nucleotides are repeated and the repeated sequences are directly adjacent to each other. The pattern can range in length from 2 to 5 base pairs and is typically in the non-coding intron region...
DYS435 with a value of 12. This low frequency value has been found as a novel Q lineage (Q5) in Indian populations.
Phylogenetic Trees
There are several confirmed and proposed phylogenetic trees available for haplogroup Q. The scientifically accepted one is the Y-Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, TexasHouston, Texas
Houston is the fourth-largest city in the United States, and the largest city in the state of Texas. According to the 2010 U.S. Census, the city had a population of 2.1 million people within an area of . Houston is the seat of Harris County and the economic center of , which is the ...
. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.
The Genomic Research Center Draft Tree
This is Thomas Krahn at the Genomic Research Center's Draft tree Proposed Tree for haplogroup Q.- PHaplogroup P (Y-DNA)In human genetics, Haplogroup P is a Y-chromosome DNA haplogroup.This haplogroup contains the patrilineal ancestors of most Europeans and almost all of the indigenous peoples of the Americas...
- Q M242
- P36.2, L232, L273, L274
- MEH2
- M120, N14, M265
- M25, M143
- M346, L56, L57
- L53, L54, L55, L213, L331
- M3, PAGES00104, PAGES00126, PAGES00131
- M19
- M194
- M199, P106, P292
- L191
- L330, L334
- L329, L332, L333
- L400, L401
- L456
- M3, PAGES00104, PAGES00126, PAGES00131
- M323
- L53, L54, L55, L213, L331
- P89.1
- L275, L314
- M378, L214, L215
- L245
- L272.1
- L315
- L301
- L327
- L245
- M378, L214, L215
- MEH2
- P36.2, L232, L273, L274
- Q M242
The Y-Chromosome Consortium 2008 tree
This is the official scientific tree produced by the Y-Chromosome Consortium (YCC). The last major update was in 2008. Subsequent updates have been quarterly and biannual.- PHaplogroup P (Y-DNA)In human genetics, Haplogroup P is a Y-chromosome DNA haplogroup.This haplogroup contains the patrilineal ancestors of most Europeans and almost all of the indigenous peoples of the Americas...
- Q M242
- Q1 P36.2
- Q1a MEH2
- Q1a1 M120, N14, M265
- Q1a2 M25, M143
- Q1a3 M346
- Q1a3a M3
- Q1a3a1 M19
- Q1a3a2 M194
- Q1a3a3 M199, P106, P292
- Q1a3b M323
- Q1a3a M3
- Q1a4 P48
- Q1a5 P89.1
- Q1b M378
- Q1a MEH2
- Q1 P36.2
- Q M242
The 2011 ISOGG Tree
The subcladeSubclade
In genetics, subclade is a term used to describe a subgroup of a subgenus or haplogroup. It is commonly used today in describing genealogical DNA tests of human mitochondrial DNA haplogroups and human Y-chromosome DNA haplogroups....
s of Haplogroup Q with their defining mutation(s), according to the 2011 ISOGG tree are provided below.
- Q M242
- Q1 P36.2, L232, L273, L274
- Q1a MEH2
- Q1a1 M120, M265/N14
- Q1a2 M25, M143
- Q1a3Haplogroup Q1a3 (Y-DNA)Haplogroup Q1a3 is a subclade of Y-DNA Haplogroup Q. Haplogroup Q1a3 is defined by the presence of the M346 Single Nucleotide Polymorphism and may therefore be referred to as Q-M346 in shorthand.- Distribution :...
L56, L57, M346, L528- Q1a3a L53, L54, L55, L213, L331
- Q1a3a1 M3
- Q1a3a1a M19
- Q1a3a1b M194
- Q1a3a1c M199, P106, P292
- Q1a3a2 L191
- Q1a3a3 L330, L334
- Q1a3a3a L329, L332, L333
- Q1a3a1 M3
- Q1a3b M323
- Q1a3c L527, L529
- Q1a3a L53, L54, L55, L213, L331
- Q1b L275, L314
- Q1b1 M378/Page100, L214, L215/Page82
- Q1b1a L245
- Q1b1a1 L272.1
- Q1b1a L245
- Q1b1 M378/Page100, L214, L215/Page82
- Q1a MEH2
- Q1 P36.2, L232, L273, L274
Distribution
Haplogroup Q may be one of the most widely distributed Y-chromosome lineages in the modern world. It is found in the AmericasAmericas
The Americas, or America , are lands in the Western hemisphere, also known as the New World. In English, the plural form the Americas is often used to refer to the landmasses of North America and South America with their associated islands and regions, while the singular form America is primarily...
, North Africa
North Africa
North Africa or Northern Africa is the northernmost region of the African continent, linked by the Sahara to Sub-Saharan Africa. Geopolitically, the United Nations definition of Northern Africa includes eight countries or territories; Algeria, Egypt, Libya, Morocco, South Sudan, Sudan, Tunisia, and...
, East Asia
East Asia
East Asia or Eastern Asia is a subregion of Asia that can be defined in either geographical or cultural terms...
, South Asia
South Asia
South Asia, also known as Southern Asia, is the southern region of the Asian continent, which comprises the sub-Himalayan countries and, for some authorities , also includes the adjoining countries to the west and the east...
, West Asia, and in Europe
Europe
Europe is, by convention, one of the world's seven continents. Comprising the westernmost peninsula of Eurasia, Europe is generally 'divided' from Asia to its east by the watershed divides of the Ural and Caucasus Mountains, the Ural River, the Caspian and Black Seas, and the waterways connecting...
.
The Americas
Haplogroup Q is the predominant Y-chromosome haplogroup in indigenous peoples of the AmericasIndigenous peoples of the Americas
The indigenous peoples of the Americas are the pre-Columbian inhabitants of North and South America, their descendants and other ethnic groups who are identified with those peoples. Indigenous peoples are known in Canada as Aboriginal peoples, and in the United States as Native Americans...
.
Approximately 20,000 to 15,000 years ago, a group migrated from Asia into the Americas
Models of migration to the New World
There have been several models for the human settlement of the Americas proposed by various academic communities. The question of how, when and why humans first entered the Americas is of intense interest to archaeologists and anthropologists, and has been a subject of heated debate for centuries...
by crossing the Bering Strait
Bering Strait
The Bering Strait , known to natives as Imakpik, is a sea strait between Cape Dezhnev, Chukotka Autonomous Okrug, Russia, the easternmost point of the Asian continent and Cape Prince of Wales, Alaska, USA, the westernmost point of the North American continent, with latitude of about 65°40'N,...
. Many of the men in this group must have belonged to haplogroup Q for it now accounts for the majority of non-European haplogroups in indigenous peoples of the Americas
Indigenous peoples of the Americas
The indigenous peoples of the Americas are the pre-Columbian inhabitants of North and South America, their descendants and other ethnic groups who are identified with those peoples. Indigenous peoples are known in Canada as Aboriginal peoples, and in the United States as Native Americans...
.
Indeed, haplogroup Q has been found in approximately 94% of Indigenous
Indigenous peoples of the Americas
The indigenous peoples of the Americas are the pre-Columbian inhabitants of North and South America, their descendants and other ethnic groups who are identified with those peoples. Indigenous peoples are known in Canada as Aboriginal peoples, and in the United States as Native Americans...
peoples of South America
South America
South America is a continent situated in the Western Hemisphere, mostly in the Southern Hemisphere, with a relatively small portion in the Northern Hemisphere. The continent is also considered a subcontinent of the Americas. It is bordered on the west by the Pacific Ocean and on the north and east...
and detected in Na-Dené speakers
Na-Dené languages
Na-Dene is a Native American language family which includes at least the Athabaskan languages, Eyak, and Tlingit languages. An inclusion of Haida is controversial....
at a rate of 25-50%, and North American Eskimo–Aleut populations at about 46%.
In more modern population groups from the Americas, all Q samples tested for M346 have been positive. This founding population spread throughout the Americas. In the Americas, a member of the founding population underwent a mutation, producing its descendant population defined by the M3 single nucleotide polymorphism
Single nucleotide polymorphism
A single-nucleotide polymorphism is a DNA sequence variation occurring when a single nucleotide — A, T, C or G — in the genome differs between members of a biological species or paired chromosomes in an individual...
(SNP). Many members of haplogroup Q in the Americas
Americas
The Americas, or America , are lands in the Western hemisphere, also known as the New World. In English, the plural form the Americas is often used to refer to the landmasses of North America and South America with their associated islands and regions, while the singular form America is primarily...
belong to the Q-M3 subclade.
However, a 4000-year-old Saqqaq
Saqqaq culture
The Saqqaq culture was a Paleo-Eskimo culture in Greenland.-Timeframe:...
individual belonging to Q-MEH2 haplogroup has been documented.
Asia
Likely due to its origin in Central AsiaCentral Asia
Central Asia is a core region of the Asian continent from the Caspian Sea in the west, China in the east, Afghanistan in the south, and Russia in the north...
, haplogroup Q may be found throughout Asia
Asia
Asia is the world's largest and most populous continent, located primarily in the eastern and northern hemispheres. It covers 8.7% of the Earth's total surface area and with approximately 3.879 billion people, it hosts 60% of the world's current human population...
. It has been reported that Q is found in the Altai people, India
India
India , officially the Republic of India , is a country in South Asia. It is the seventh-largest country by geographical area, the second-most populous country with over 1.2 billion people, and the most populous democracy in the world...
, Tibet
Tibet
Tibet is a plateau region in Asia, north-east of the Himalayas. It is the traditional homeland of the Tibetan people as well as some other ethnic groups such as Monpas, Qiang, and Lhobas, and is now also inhabited by considerable numbers of Han and Hui people...
, Pakistan
Pakistan
Pakistan , officially the Islamic Republic of Pakistan is a sovereign state in South Asia. It has a coastline along the Arabian Sea and the Gulf of Oman in the south and is bordered by Afghanistan and Iran in the west, India in the east and China in the far northeast. In the north, Tajikistan...
, China
China
Chinese civilization may refer to:* China for more general discussion of the country.* Chinese culture* Greater China, the transnational community of ethnic Chinese.* History of China* Sinosphere, the area historically affected by Chinese culture...
, Mongolia
Mongolia
Mongolia is a landlocked country in East and Central Asia. It is bordered by Russia to the north and China to the south, east and west. Although Mongolia does not share a border with Kazakhstan, its western-most point is only from Kazakhstan's eastern tip. Ulan Bator, the capital and largest...
, Tuvans
Tuvans
Tuvans or Tuvinians are Turkic peoples living in southern Siberia. They are historically known as one of the Uriankhai, from the Mongolian designation...
, and Uyghurs
Uyghur people
The Uyghur are a Turkic ethnic group living in Eastern and Central Asia. Today, Uyghurs live primarily in the Xinjiang Uyghur Autonomous Region in the People's Republic of China...
.
East Asia
To the east, haplogroup Q has been found in approximately 4% of Southern Altaians and 32% of Northern Altaians. It is found in 16% of TuvansTuvans
Tuvans or Tuvinians are Turkic peoples living in southern Siberia. They are historically known as one of the Uriankhai, from the Mongolian designation...
.
The frequency of Q in northern China is about 4%, with many Chinese samples of haplogroup Q belonging to the subclade Q-M120. Haplogroup Q is found in approximately 3% of males in Tibet
Tibet
Tibet is a plateau region in Asia, north-east of the Himalayas. It is the traditional homeland of the Tibetan people as well as some other ethnic groups such as Monpas, Qiang, and Lhobas, and is now also inhabited by considerable numbers of Han and Hui people...
and Mongolia
Mongolia
Mongolia is a landlocked country in East and Central Asia. It is bordered by Russia to the north and China to the south, east and west. Although Mongolia does not share a border with Kazakhstan, its western-most point is only from Kazakhstan's eastern tip. Ulan Bator, the capital and largest...
.
It is also found in 3% of Uyghurs
Uyghur people
The Uyghur are a Turkic ethnic group living in Eastern and Central Asia. Today, Uyghurs live primarily in the Xinjiang Uyghur Autonomous Region in the People's Republic of China...
.
The highest frequencies of Q in Asia are found among the Selkups (~70%) and Kets (~95%), they live in western and middle Siberia
Siberia
Siberia is an extensive region constituting almost all of Northern Asia. Comprising the central and eastern portion of the Russian Federation, it was part of the Soviet Union from its beginning, as its predecessor states, the Tsardom of Russia and the Russian Empire, conquered it during the 16th...
and their populations are small in number, being just under 5,000 and 1,500, respectively.
South Asia
A Biomed study observed an ancestral state Q* and a novel sub-branch Q5, not reported elsewhere, in the Indian subcontinentIndian subcontinent
The Indian subcontinent, also Indian Subcontinent, Indo-Pak Subcontinent or South Asian Subcontinent is a region of the Asian continent on the Indian tectonic plate from the Hindu Kush or Hindu Koh, Himalayas and including the Kuen Lun and Karakoram ranges, forming a land mass which extends...
, though in low frequency. A novel subgroup Q4 was identified recently which is also restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to the Indian subcontinent followed by an autochthonous differentiation
Indigenous peoples
Indigenous peoples are ethnic groups that are defined as indigenous according to one of the various definitions of the term, there is no universally accepted definition but most of which carry connotations of being the "original inhabitants" of a territory....
to Q4 and Q5 sublineages later on. Thus the subcontinent has three novel Q lineages, an ancestral Q* (different from the Central Asian Q*), Q4 and Q5 unique to the subcontinent.
West Asia
Two studies conducted Ivan Nasidze in 2004 and 2009, show that the frequency of Q in Iran, varies between approximately 2% to 6%, depending on region. Iranian samples of haplogroup Q belong primarily to the subclade Q-M25.In Pakistan
Pakistan
Pakistan , officially the Islamic Republic of Pakistan is a sovereign state in South Asia. It has a coastline along the Arabian Sea and the Gulf of Oman in the south and is bordered by Afghanistan and Iran in the west, India in the east and China in the far northeast. In the north, Tajikistan...
, at the eastern end of the Iranian plateau, the frequency of haplogroup Q is about 2.2% (14/638) or 3.4% (6/176).
Approximately 2.5% of males in Saudi Arabia
Saudi Arabia
The Kingdom of Saudi Arabia , commonly known in British English as Saudi Arabia and in Arabic as as-Sa‘ūdiyyah , is the largest state in Western Asia by land area, constituting the bulk of the Arabian Peninsula, and the second-largest in the Arab World...
belong to haplogroup Q.
According to Behar et al. 5% of Ashkenazi males belong to haplogroup Q. This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245.
Haplogroup Q has also been found in Algeria
Algeria
Algeria , officially the People's Democratic Republic of Algeria , also formally referred to as the Democratic and Popular Republic of Algeria, is a country in the Maghreb region of Northwest Africa with Algiers as its capital.In terms of land area, it is the largest country in Africa and the Arab...
ns, Arabians, Syrians, Lebanese
Lebanese people
The Lebanese people are a nation and ethnic group of Levantine people originating in what is today the country of Lebanon, including those who had inhabited Mount Lebanon prior to the creation of the modern Lebanese state....
and the United Arab Emirates
United Arab Emirates
The United Arab Emirates, abbreviated as the UAE, or shortened to "the Emirates", is a state situated in the southeast of the Arabian Peninsula in Western Asia on the Persian Gulf, bordering Oman, and Saudi Arabia, and sharing sea borders with Iraq, Kuwait, Bahrain, Qatar, and Iran.The UAE is a...
.,
Europe
The frequency of haplogroup Q in NorwayNorway
Norway , officially the Kingdom of Norway, is a Nordic unitary constitutional monarchy whose territory comprises the western portion of the Scandinavian Peninsula, Jan Mayen, and the Arctic archipelago of Svalbard and Bouvet Island. Norway has a total area of and a population of about 4.9 million...
and Sweden
Sweden
Sweden , officially the Kingdom of Sweden , is a Nordic country on the Scandinavian Peninsula in Northern Europe. Sweden borders with Norway and Finland and is connected to Denmark by a bridge-tunnel across the Öresund....
is about 3%, while 2,5% of Slovak males are in haplogroup Q.
To the south east, approximately 2% of males in Turkey
Turkey
Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...
, In a study by Gokcumen it was found that among Turks
Turkish people
Turkish people, also known as the "Turks" , are an ethnic group primarily living in Turkey and in the former lands of the Ottoman Empire where Turkish minorities had been established in Bulgaria, Cyprus, Bosnia and Herzegovina, Georgia, Greece, Kosovo, Macedonia, and Romania...
that belong to the Afshar tribe
Afshar tribe
Afshars, also called Avshar are a branch of the Turkic Oghuz groups. These originally nomadic Oghuz tribes moved from Central Asia through Iran, Afghanistan, Syria, and finally most of them settled in Anatolia.Most of Afshars are followers of Shia Islam....
haplogroup Q is seen with a prevalence of 13%. Further, the Q-M25 subclade has been found in Turkey
Turkey
Turkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe...
Q-M346 is found among the Khanty
Khanty people
Khanty / Hanti are an indigenous people calling themselves Khanti, Khande, Kantek , living in Khanty-Mansi Autonomous Okrug, a region historically known as "Yugra" in Russia, together with the Mansi. In the autonomous okrug, the Khanty and Mansi languages are given co-official status with Russian...
.
Population Frequencies from Studies
| Population | Paper | N | Percentage | SNPs Tested | |
|---|---|---|---|---|---|
| Austro-Asiatic (Khasi-Khmuic) | Reddy 2009 | 353 | 5.40 | P-M45(xM173) § | |
| Austro-Asiatic (Mundari) | Reddy 2009 | 64 | 10.90 | P-M45(xM173) § | |
| Nicobarese (Mon-Khmer) | Reddy 2009 | 11 | 0.00 | P-M45(xM173) § | |
| Austro-Asiatic (Southeast Asia) | Reddy 2009 | 257 | 1.60 | P-M45(xM173) § | |
| Garo (Tibeto-Burman) | Reddy 2009 | 71 | 1.40 | P-M45(xM173) § | |
| Tibeto-Burman (India) | Reddy 2009 | 226 | 3.10 | P-M45(xM173) § | |
| Tibeto-Burman (East Asia) | Reddy 2009 | 214 | 0.00 | P-M45(xM173) § | |
| Indo-European (Eastern India) | Reddy 2009 | 54 | 18.50 | P-M45(xM173) § | |
| Southern Talysh | Iran | Nasidze 2009 | 50 | 4.00 | P-M45(xM124,xM173) |
| Northern Talysh | Azerbaijan | Nasidze 2009 | 40 | 5.00 | P-M45(xM124,xM173) |
| Mazandarana | Iran | Nasidze 2009 | 50 | 4.00 | P-M45(xM124,xM173) |
| Gilakia | Iran | Nasidze 2009 | 50 | 0.00 | P-M45(xM124,xM173) |
| Iranians (Tehran) | Iran | Nasidze 2004 | 80 | 4.00 | P-M45(xM124,xM173) |
| Iranians (Isfahan) | Iran | Nasidze 2004 | 50 | 6.00 | P-M45(xM124,xM173) |
| Bakhtiari | Iran | Nasidze 2008 | 53 | 2.00 | P-M45(xM124,xM173) |
| Iranian Arabs | Iran | Nasidze 2008 | 47 | 2.00 | P-M45(xM124,xM173) |
| North Iran | Iran | Regueiro 2006 | 33 | 9.00 | P-M45(xM124,xM173) |
| South Iran | Iran | Regueiro 2006 | 117 | 3.00 | P-M45(xM124,xM173) |
| Georgians | South Caucacus | Nasidze and Stoneking 2001 | 77 | 3.00 | P-M45(xM124,xM173) |
| Armenians | South Caucacus | Nasidze and Stoneking 2001 | 100 | 2.00 | P-M45(xM124,xM173) |
| Azerbaijanis | South Caucacus | Nasidze and Stoneking 2001 | 72 | 0.00 | P-M45(xM124,xM173) |
§ These may include members of haplogroup R2
Haplogroup R2 (Y-DNA)
- Paragroup R2a* :Paragroup is a term used in population genetics to describe lineages within a haplogroup that are not defined by any additional unique markers...
.
Subclade Distribution
- Q (M242)
- Q* — Found with low frequency in IndiaIndiaIndia , officially the Republic of India , is a country in South Asia. It is the seventh-largest country by geographical area, the second-most populous country with over 1.2 billion people, and the most populous democracy in the world...
and PakistanPakistanPakistan , officially the Islamic Republic of Pakistan is a sovereign state in South Asia. It has a coastline along the Arabian Sea and the Gulf of Oman in the south and is bordered by Afghanistan and Iran in the west, India in the east and China in the far northeast. In the north, Tajikistan...
. - Q1 (P36.2)
- Q1a (MEH2)
- Q1a* Was found in KoryaksKoryaksKoryaks are an indigenous people of Kamchatka Krai in the Russian Far East, who inhabit the coastlands of the Bering Sea to the south of the Anadyr basin and the country to the immediate north of the Kamchatka Peninsula, the southernmost limit of their range being Tigilsk. They are akin to the...
(at 10.3%), although the level of STR diversity associated with Q1a*-MEH2 is very low, this lineage appears to be closest to the extinct Palaeo-Eskimo individuals belonging to the Saqqaq cultureSaqqaq cultureThe Saqqaq culture was a Paleo-Eskimo culture in Greenland.-Timeframe:...
arisen in the New World Arctic about 5.5 Ka. - Q1a1 (M120, M265/N14) (formerly Q1) — It is so far restricted to East Asia. It has been found at low frequency among Han ChineseHan ChineseHan Chinese are an ethnic group native to China and are the largest single ethnic group in the world.Han Chinese constitute about 92% of the population of the People's Republic of China , 98% of the population of the Republic of China , 78% of the population of Singapore, and about 20% of the...
, Dungans, JapaneseJapanese peopleThe are an ethnic group originating in the Japanese archipelago and are the predominant ethnic group of Japan. Worldwide, approximately 130 million people are of Japanese descent; of these, approximately 127 million are residents of Japan. People of Japanese ancestry who live in other countries...
, Koreans, and Tibetans. Although it was reported in the Hazaras, it was subsequently shown to be a lab error as demonstrated by the phylogenetic tree changes in Karafet 2008. - Q1a2 (M25, M143) (formerly Q2) — Found with low to moderate frequency in IranIranIran , officially the Islamic Republic of Iran , is a country in Southern and Western Asia. The name "Iran" has been in use natively since the Sassanian era and came into use internationally in 1935, before which the country was known to the Western world as Persia...
, LebanonLebanonLebanon , officially the Republic of LebanonRepublic of Lebanon is the most common term used by Lebanese government agencies. The term Lebanese Republic, a literal translation of the official Arabic and French names that is not used in today's world. Arabic is the most common language spoken among...
, and TurkeyTurkeyTurkey , known officially as the Republic of Turkey , is a Eurasian country located in Western Asia and in East Thrace in Southeastern Europe... - Q1a3Haplogroup Q1a3 (Y-DNA)Haplogroup Q1a3 is a subclade of Y-DNA Haplogroup Q. Haplogroup Q1a3 is defined by the presence of the M346 Single Nucleotide Polymorphism and may therefore be referred to as Q-M346 in shorthand.- Distribution :...
(L56, L57, M346) (called formerly Q4 or Q6) — Found at low frequency in Europe, South Asia and West Asia. Including its Q-M3 subclade, it is the only branch of haplogroup Q found in modern indigenous populations of the Americas. It has been found in PakistanPakistanPakistan , officially the Islamic Republic of Pakistan is a sovereign state in South Asia. It has a coastline along the Arabian Sea and the Gulf of Oman in the south and is bordered by Afghanistan and Iran in the west, India in the east and China in the far northeast. In the north, Tajikistan...
, Saudi ArabiaSaudi ArabiaThe Kingdom of Saudi Arabia , commonly known in British English as Saudi Arabia and in Arabic as as-Sa‘ūdiyyah , is the largest state in Western Asia by land area, constituting the bulk of the Arabian Peninsula, and the second-largest in the Arab World...
, the United Arab EmiratesUnited Arab EmiratesThe United Arab Emirates, abbreviated as the UAE, or shortened to "the Emirates", is a state situated in the southeast of the Arabian Peninsula in Western Asia on the Persian Gulf, bordering Oman, and Saudi Arabia, and sharing sea borders with Iraq, Kuwait, Bahrain, Qatar, and Iran.The UAE is a...
, IndiaIndiaIndia , officially the Republic of India , is a country in South Asia. It is the seventh-largest country by geographical area, the second-most populous country with over 1.2 billion people, and the most populous democracy in the world...
and Tibet.- Q1a3a (L53, L54, L55, L213)
- Q1a3a1 (M3) (formerly Q3) — Typical of indigenous peoples of the AmericasIndigenous peoples of the AmericasThe indigenous peoples of the Americas are the pre-Columbian inhabitants of North and South America, their descendants and other ethnic groups who are identified with those peoples. Indigenous peoples are known in Canada as Aboriginal peoples, and in the United States as Native Americans...
- Q1a3a1a (M19) — Found among some indigenous peoples of South AmericaSouth AmericaSouth America is a continent situated in the Western Hemisphere, mostly in the Southern Hemisphere, with a relatively small portion in the Northern Hemisphere. The continent is also considered a subcontinent of the Americas. It is bordered on the west by the Pacific Ocean and on the north and east...
, such as the Ticuna and the WayuuWayuuWayuu is an Amerindian ethnic group of the La Guajira Peninsula in northern Colombia and northwest Venezuela. They are part of the Maipurean language family.- Geography :... - Q1a3a1b (M194) — In South America
- Q1a3a1c (M199, P106, P292) — In South America
- Q1a3a1a (M19) — Found among some indigenous peoples of South America
- Q1a3a1 (M3) (formerly Q3) — Typical of indigenous peoples of the Americas
- Q1a3b (M323) (called successively Q4, Q6 and Q5) — It has been detected in Yemenite JewsYemenite JewsYemenite Jews are those Jews who live, or whose recent ancestors lived, in Yemen . Between June 1949 and September 1950, the overwhelming majority of Yemen's Jewish population was transported to Israel in Operation Magic Carpet...
.
- Q1a3a (L53, L54, L55, L213)
- Q1a* Was found in Koryaks
- Q1b (L275, L314)
- Q1b1 (M378) — It is widely distributed in Europe, South Asia, and West Asia. It is found among samples of Hazaras and SindhisSindhi peopleSindhis are a Sindhi speaking socio-ethnic group of people originating from Sindh, a province Formerly of British India, now in Pakistan. Today Sindhis that live in Pakistan belong to various religious denominations including Islam, Zoroastrianism, Hinduism, Sikhism and Christianity...
. It is also found in the UyghursUyghur peopleThe Uyghur are a Turkic ethnic group living in Eastern and Central Asia. Today, Uyghurs live primarily in the Xinjiang Uyghur Autonomous Region in the People's Republic of China...
of North-Western ChinaChinaChinese civilization may refer to:* China for more general discussion of the country.* Chinese culture* Greater China, the transnational community of ethnic Chinese.* History of China* Sinosphere, the area historically affected by Chinese culture...
in two separate groups. The Q-M378 subclade and specifically its Q-L245 subbranch is speculated to be the branch to which Q-M242 men in Jewish Diaspora populations belong. Although published articles have not tested for M378 in Jewish populations, genetic genealogistsGenetic genealogyGenetic genealogy is the application of genetics to traditional genealogy. Genetic genealogy involves the use of genealogical DNA testing to determine the level of genetic relationship between individuals.-History:...
from the Ashkenazi, MizrachiMizrahi JewsMizrahi Jews or Mizrahiyim, , also referred to as Adot HaMizrach are Jews descended from the Jewish communities of the Middle East, North Africa and the Caucasus...
, and Sephardi Jewish populations have tested positive for both M378 and L245.
- Q1b1 (M378) — It is widely distributed in Europe, South Asia, and West Asia. It is found among samples of Hazaras and Sindhis
- Q1a (MEH2)
- Q* — Found with low frequency in India
See also
- Populations
- Indigenous peoples of the AmericasIndigenous peoples of the AmericasThe indigenous peoples of the Americas are the pre-Columbian inhabitants of North and South America, their descendants and other ethnic groups who are identified with those peoples. Indigenous peoples are known in Canada as Aboriginal peoples, and in the United States as Native Americans...
- Ashkenazi JewsAshkenazi JewsAshkenazi Jews, also known as Ashkenazic Jews or Ashkenazim , are the Jews descended from the medieval Jewish communities along the Rhine in Germany from Alsace in the south to the Rhineland in the north. Ashkenaz is the medieval Hebrew name for this region and thus for Germany...
- Hazara
- Paleo-Indians
- Selkups
- Sephardic Jews
- Ticuna
- Indian populationsEthnic groups of South AsiaThe ethno-linguistic composition of the population of South Asia, that is the nations of India, Pakistan, Bangladesh, Nepal, Bhutan, Maldives and Sri Lanka is highly diverse. The majority of the population fall within two large Linguistic groups, Indo-Aryan and Dravidian.These groups are further...
- Yemenite JewsYemenite JewsYemenite Jews are those Jews who live, or whose recent ancestors lived, in Yemen . Between June 1949 and September 1950, the overwhelming majority of Yemen's Jewish population was transported to Israel in Operation Magic Carpet...
- Indigenous peoples of the Americas
- Genetics
- HaplogroupHaplogroupIn the study of molecular evolution, a haplogroup is a group of similar haplotypes that share a common ancestor having the same single nucleotide polymorphism mutation in both haplotypes. Because a haplogroup consists of similar haplotypes, this is what makes it possible to predict a haplogroup...
- HaplotypeHaplotypeA haplotype in genetics is a combination of alleles at adjacent locations on the chromosome that are transmitted together...
- SubcladeSubcladeIn genetics, subclade is a term used to describe a subgroup of a subgenus or haplogroup. It is commonly used today in describing genealogical DNA tests of human mitochondrial DNA haplogroups and human Y-chromosome DNA haplogroups....
- Paragroup
- Haplogroup
- Subclades
- Q1a3a1 (The only Y Chromosome haplogroup strictly associated with the indigenous peoples of the Americas.)
External links
- Q Y-Haplogroup Project at FTDNA
- American Indian Q3 project at FTDNA
- Spread of Haplogroup Q, from The Genographic ProjectThe Genographic ProjectThe Genographic Project, launched on April 13, 2005 by the National Geographic Society and IBM, is a multi-year genetic anthropology study that aims to map historical human migration patterns by collecting and analyzing DNA samples from hundreds of thousands of people from around the...
, National Geographic - The India Genealogical DNA Project
- British Isles DNA Project

