Alu sequence
Encyclopedia
An Alu element is a short stretch of DNA
originally characterized by the action of the Alu restriction
endonuclease
. Alu elements of different kinds occur in large numbers in primate genome
s. In fact, Alu elements are the most abundant mobile elements in the human genome. They are derived from the small cytoplasmic 7SL RNA
, a component of the signal recognition particle
. The event, when a copy of the 7SL RNA became a precursor of the Alu elements, took place in the genome of an ancestor of Supraprimates.
Alu insertions have been implicated in several inherited human diseases and in various forms of cancer.
The study of Alu elements has also been important in elucidating
human population genetics
and the evolution
of primate
s, including the evolution of humans
.
genome
. Modern Alu elements are about 300 base pair
s long and are therefore classified as short interspersed elements (SINEs) among the class of repetitive DNA elements. The typical structure is
5'Part A- A5TACA6 -Part B - PolyA Tail - 3'
where Part A and Part B are similar peptide sequences, but of opposite direction. Expressed another way, it is believed modern
Alu elements emerged from a head to tail fusion of two distinct FAMs (fossil antique monomers)over 100 mkya. Hence its dimeric structure of two similar but distinct monomers (left and right arms, and in opposite directions)joined by an A-rich linker. The length of the polyA tail varies between Alu families.
There are over one million Alu elements interspersed throughout the human genome, and it is estimated that about 10.7% of the human genome consists of Alu sequences. However less than 0.5% are polymorphic
. In 1988 Alu elements were split in two major subfamilies known as AluJ and AluS, and numerous sub-subfamilies. Later on, a sub-subfamily of AluS which included active Alu elements was given a separate name AluY. The discovery of Alu subfamilies led to the hypothesis of master/source genes, and provided the definitive link between transposable elements (active elements) and interspersed repetitive DNA (mutated copies of active elements).
gccgggcgcggtggcgcgtgcctgtagtcccagctactcgggaggctgAGGCTGgaGGATCGcttgAGTCCAggAGTTCTgggct
gtagtgcgctatgccgatcgggtgtccgcactaagttcggcatcaatatggtgacctcccgggagcgggggaccaccaggttgcctaagga
ggggtgaaccggcccaggtcggaaacggagcaggtcaaaactcccgtgctgatcagtagtgggatcgcgcctgtgaatagccactgcactc
cagcctgggcaacatagcgagaccccgtctct
The functional retinoic acid
response element hexamer sites are in upper case and overlap the internal transcriptional promoter. The recognition sequence of the Alu endonuclease is 5' AG/CT 3'; that is, the enzyme cuts the DNA segment between the guanine
and cytosine
residues (in bold above). The Alu endonuclease is so-named because it was isolated from Arthrobacter luteus
.
s and look like DNA copies made from RNA polymerase III
-encoded RNAs. Alu elements do not encode for protein products and depend on LINE retrotransposons for their replication.
Alu elements in primates form a fossil record that is relatively easy to decipher because Alu elements insertion events have a characteristic signature that is both easy to read and faithfully recorded in the genome from generation to generation. The study of Alu elements thus reveals details of ancestry because individuals will only share a particular Alu element insertion if they have a common ancestor.
Most human Alu element insertions can be found in the corresponding positions in the genomes of other primates, but about 7,000 Alu insertions are unique to humans.
does not mean that the carrier will definitely get the disease. The first report of Alu-mediated recombination
causing a prevalent inherited predisposition to cancer was a 1995 report about hereditary nonpolyposis colorectal cancer
.
The following human diseases have been linked with Alu insertions:
And the following diseases have been associated with single-nucleotide DNA variations in Alu elements impacting transcription levels:
DNA
Deoxyribonucleic acid is a nucleic acid that contains the genetic instructions used in the development and functioning of all known living organisms . The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in...
originally characterized by the action of the Alu restriction
Restriction enzyme
A Restriction Enzyme is an enzyme that cuts double-stranded DNA at specific recognition nucleotide sequences known as restriction sites. Such enzymes, found in bacteria and archaea, are thought to have evolved to provide a defense mechanism against invading viruses...
endonuclease
Endonuclease
Endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain, in contrast to exonucleases, which cleave phosphodiester bonds at the end of a polynucleotide chain. Typically, a restriction site will be a palindromic sequence four to six nucleotides long. Most...
. Alu elements of different kinds occur in large numbers in primate genome
Genome
In modern molecular biology and genetics, the genome is the entirety of an organism's hereditary information. It is encoded either in DNA or, for many types of virus, in RNA. The genome includes both the genes and the non-coding sequences of the DNA/RNA....
s. In fact, Alu elements are the most abundant mobile elements in the human genome. They are derived from the small cytoplasmic 7SL RNA
7SL RNA
The signal recognition particle RNA, also known as 7SL, 6S, , or 4.5S RNA, is the RNA component of the signal recognition particle ribonucleoprotein complex. SRP is a universally conserved ribonucleoprotein that directs the traffic of proteins within the cell and allows them to be secreted...
, a component of the signal recognition particle
Signal recognition particle
The signal recognition particle is an abundant, cytosolic, universally conserved ribonucleoprotein that recognizes and targets specific proteins to the endoplasmic reticulum in eukaryotes and the plasma membrane in prokaryotes....
. The event, when a copy of the 7SL RNA became a precursor of the Alu elements, took place in the genome of an ancestor of Supraprimates.
Alu insertions have been implicated in several inherited human diseases and in various forms of cancer.
The study of Alu elements has also been important in elucidating
human population genetics
Population genetics
Population genetics is the study of allele frequency distribution and change under the influence of the four main evolutionary processes: natural selection, genetic drift, mutation and gene flow. It also takes into account the factors of recombination, population subdivision and population...
and the evolution
Evolution
Evolution is any change across successive generations in the heritable characteristics of biological populations. Evolutionary processes give rise to diversity at every level of biological organisation, including species, individual organisms and molecules such as DNA and proteins.Life on Earth...
of primate
Primate
A primate is a mammal of the order Primates , which contains prosimians and simians. Primates arose from ancestors that lived in the trees of tropical forests; many primate characteristics represent adaptations to life in this challenging three-dimensional environment...
s, including the evolution of humans
Human evolution
Human evolution refers to the evolutionary history of the genus Homo, including the emergence of Homo sapiens as a distinct species and as a unique category of hominids and mammals...
.
The Alu family
The Alu family is a family of repetitive elements in the humanHuman
Humans are the only living species in the Homo genus...
genome
Genome
In modern molecular biology and genetics, the genome is the entirety of an organism's hereditary information. It is encoded either in DNA or, for many types of virus, in RNA. The genome includes both the genes and the non-coding sequences of the DNA/RNA....
. Modern Alu elements are about 300 base pair
Base pair
In molecular biology and genetics, the linking between two nitrogenous bases on opposite complementary DNA or certain types of RNA strands that are connected via hydrogen bonds is called a base pair...
s long and are therefore classified as short interspersed elements (SINEs) among the class of repetitive DNA elements. The typical structure is
5'Part A- A5TACA6 -Part B - PolyA Tail - 3'
where Part A and Part B are similar peptide sequences, but of opposite direction. Expressed another way, it is believed modern
Alu elements emerged from a head to tail fusion of two distinct FAMs (fossil antique monomers)over 100 mkya. Hence its dimeric structure of two similar but distinct monomers (left and right arms, and in opposite directions)joined by an A-rich linker. The length of the polyA tail varies between Alu families.
There are over one million Alu elements interspersed throughout the human genome, and it is estimated that about 10.7% of the human genome consists of Alu sequences. However less than 0.5% are polymorphic
Polymorphism (biology)
Polymorphism in biology occurs when two or more clearly different phenotypes exist in the same population of a species — in other words, the occurrence of more than one form or morph...
. In 1988 Alu elements were split in two major subfamilies known as AluJ and AluS, and numerous sub-subfamilies. Later on, a sub-subfamily of AluS which included active Alu elements was given a separate name AluY. The discovery of Alu subfamilies led to the hypothesis of master/source genes, and provided the definitive link between transposable elements (active elements) and interspersed repetitive DNA (mutated copies of active elements).
7SL RNA
The sequence of the DNA for the 299 nucleotide long 7SL RNA :gccgggcgcggtggcgcgtgcctgtagtcccagctactcgggaggctgAGGCTGgaGGATCGcttgAGTCCAggAGTTCTgggct
gtagtgcgctatgccgatcgggtgtccgcactaagttcggcatcaatatggtgacctcccgggagcgggggaccaccaggttgcctaagga
ggggtgaaccggcccaggtcggaaacggagcaggtcaaaactcccgtgctgatcagtagtgggatcgcgcctgtgaatagccactgcactc
cagcctgggcaacatagcgagaccccgtctct
The functional retinoic acid
Retinoic acid
Retinoic acid is a metabolite of vitamin A that mediates the functions of vitamin A required for growth and development. Retinoic acid is required in chordate animals which includes all higher animals from fishes to humans...
response element hexamer sites are in upper case and overlap the internal transcriptional promoter. The recognition sequence of the Alu endonuclease is 5' AG/CT 3'; that is, the enzyme cuts the DNA segment between the guanine
Guanine
Guanine is one of the four main nucleobases found in the nucleic acids DNA and RNA, the others being adenine, cytosine, and thymine . In DNA, guanine is paired with cytosine. With the formula C5H5N5O, guanine is a derivative of purine, consisting of a fused pyrimidine-imidazole ring system with...
and cytosine
Cytosine
Cytosine is one of the four main bases found in DNA and RNA, along with adenine, guanine, and thymine . It is a pyrimidine derivative, with a heterocyclic aromatic ring and two substituents attached . The nucleoside of cytosine is cytidine...
residues (in bold above). The Alu endonuclease is so-named because it was isolated from Arthrobacter luteus
Arthrobacter
Arthrobacter is a genus of bacteria that is commonly found in soil. All species in this genus are Gram-positive obligate aerobes that are rods during exponential growth and cocci in their stationary phase....
.
Alu elements
Alu elements are retrotransposonRetrotransposon
Retrotransposons are genetic elements that can amplify themselves in a genome and are ubiquitous components of the DNA of many eukaryotic organisms. They are a subclass of transposon. They are particularly abundant in plants, where they are often a principal component of nuclear DNA...
s and look like DNA copies made from RNA polymerase III
RNA polymerase III
RNA polymerase III transcribes DNA to synthesize ribosomal 5S rRNA, tRNA and other small RNAs. The genes transcribed by RNA Pol III fall in the category of "housekeeping" genes whose expression is required in all cell types and most environmental conditions...
-encoded RNAs. Alu elements do not encode for protein products and depend on LINE retrotransposons for their replication.
Alu elements in primates form a fossil record that is relatively easy to decipher because Alu elements insertion events have a characteristic signature that is both easy to read and faithfully recorded in the genome from generation to generation. The study of Alu elements thus reveals details of ancestry because individuals will only share a particular Alu element insertion if they have a common ancestor.
Most human Alu element insertions can be found in the corresponding positions in the genomes of other primates, but about 7,000 Alu insertions are unique to humans.
Impact of Alu in humans
Alu elements are a common source of mutation in humans, but such mutations are often confined to non-coding regions where they have little discernible impact on the bearer. However, the variation generated can be used in studies of the movement and ancestry of human populations, and the mutagenic effect of Alu and retrotransposons in general has played a major role in the recent evolution of the human genome. There are also a number of cases where Alu insertions or deletions are associated with specific effects in humans:Associations with human disease
Alu insertions are sometimes disruptive and can result in inherited disorders. However, most Alu variation acts as markers that segregate with the disease so the presence of a particular Alu alleleAllele
An allele is one of two or more forms of a gene or a genetic locus . "Allel" is an abbreviation of allelomorph. Sometimes, different alleles can result in different observable phenotypic traits, such as different pigmentation...
does not mean that the carrier will definitely get the disease. The first report of Alu-mediated recombination
Genetic recombination
Genetic recombination is a process by which a molecule of nucleic acid is broken and then joined to a different one. Recombination can occur between similar molecules of DNA, as in homologous recombination, or dissimilar molecules, as in non-homologous end joining. Recombination is a common method...
causing a prevalent inherited predisposition to cancer was a 1995 report about hereditary nonpolyposis colorectal cancer
Colorectal cancer
Colorectal cancer, commonly known as bowel cancer, is a cancer caused by uncontrolled cell growth , in the colon, rectum, or vermiform appendix. Colorectal cancer is clinically distinct from anal cancer, which affects the anus....
.
The following human diseases have been linked with Alu insertions:
- Breast cancerBreast cancerBreast cancer is cancer originating from breast tissue, most commonly from the inner lining of milk ducts or the lobules that supply the ducts with milk. Cancers originating from ducts are known as ductal carcinomas; those originating from lobules are known as lobular carcinomas...
- Ewing's sarcoma
- Familial hypercholesterolemiaFamilial hypercholesterolemiaFamilial hypercholesterolemia is a genetic disorder characterized by high cholesterol levels, specifically very high levels of low-density lipoprotein , in the blood and early cardiovascular disease...
- Hemophilia
- NeurofibromatosisNeurofibromatosisNeurofibromatosis is a genetically-inherited disorder in which the nerve tissue grows tumors that may be benign or may cause serious damage by compressing nerves and other tissues...
- Diabetes mellitusDiabetes mellitusDiabetes mellitus, often simply referred to as diabetes, is a group of metabolic diseases in which a person has high blood sugar, either because the body does not produce enough insulin, or because cells do not respond to the insulin that is produced...
type II
And the following diseases have been associated with single-nucleotide DNA variations in Alu elements impacting transcription levels:
- Alzheimer's diseaseAlzheimer's diseaseAlzheimer's disease also known in medical literature as Alzheimer disease is the most common form of dementia. There is no cure for the disease, which worsens as it progresses, and eventually leads to death...
- Lung cancerLung cancerLung cancer is a disease characterized by uncontrolled cell growth in tissues of the lung. If left untreated, this growth can spread beyond the lung in a process called metastasis into nearby tissue and, eventually, into other parts of the body. Most cancers that start in lung, known as primary...
- Gastric cancer
Other alu-associated human mutations
- The ACE gene, encoding Angiotensin-converting enzymeAngiotensin-converting enzymeAngiotensin I-converting enzyme , an exopeptidase, is a circulating enzyme that participates in the body's renin-angiotensin system , which mediates extracellular volume , and arterial vasoconstriction...
, has 2 common variants, one with an Alu insertion (ACE-I) and one with the Alu deleted (ACE-D). This variation has been linked to changes in sporting ability: the presence of the Alu element is associated with better performance in endurance-oriented events (e.g. triathlons), whereas its absence is associated with strength- and power-oriented performance - The opsinOpsinOpsins are a group of light-sensitive 35–55 kDa membrane-bound G protein-coupled receptors of the retinylidene protein family found in photoreceptor cells of the retina. Five classical groups of opsins are involved in vision, mediating the conversion of a photon of light into an electrochemical...
gene duplicationGene duplicationGene duplication is any duplication of a region of DNA that contains a gene; it may occur as an error in homologous recombination, a retrotransposition event, or duplication of an entire chromosome.The second copy of the gene is often free from selective pressure — that is, mutations of it have no...
which resultedEvolution of color vision in primatesThe evolution of color vision in primates is unique compared to most eutherian mammals. A remote vertebrate ancestor of primates possessed tetrachromacy, but nocturnal, warm-blooded, mammalian ancestors lost two of four cones in the retina at the time of dinosaurs...
in the re-gaining of trichromacy in Old World primatesCatarrhiniCatarrhini is one of the two subdivisions of the higher primates . It contains the Old World monkeys and the apes, which in turn are further divided into the lesser apes or gibbons and the great apes, consisting of the orangutans, gorillas, chimpanzees, bonobos, and humans...
(including humans) is flanked by an Alu element, implicating the role of Alu in the evolution of three colour vision.
External links
- AF-1(Alu Finder):A web server to find Alu elements in primate genomes.