The homing endonucleases are a special type of restriction enzymes encoded by intron

Intron

An intron is any nucleotide sequence within a gene that is removed by RNA splicing to generate the final mature RNA product of a gene. The term intron refers to both the DNA sequence within a gene, and the corresponding sequence in RNA transcripts. Sequences that are joined together in the final...

s or intein

Intein

An intein is a segment of a protein that is able to excise itself and rejoin the remaining portions with a peptide bond. Inteins have also been called "protein introns"....

s. They acts on the own cellular DNA

DNA

Deoxyribonucleic acid is a nucleic acid that contains the genetic instructions used in the development and functioning of all known living organisms . The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in...

 of the cell that synthesize them; to be precise, in the opposite allele

Allele

An allele is one of two or more forms of a gene or a genetic locus . "Allel" is an abbreviation of allelomorph. Sometimes, different alleles can result in different observable phenotypic traits, such as different pigmentation...

 of the gene

Gene

A gene is a molecular unit of heredity of a living organism. It is a name given to some stretches of DNA and RNA that code for a type of protein or for an RNA chain that has a function in the organism. Living beings depend on genes, as they specify all proteins and functional RNA chains...

 that encode them.

Further information: Homing endonuclease

Homing endonuclease

The homing endonucleases are a type of restriction enzymes typically encoded by introns or inteins. They act on the cellular DNA of the cells that synthesize them, in the opposite alleles of the genes that encode them.- Origin and mechanism :...

.

Homing endonucleases

The list includes some of the most studied examples. The following concepts have been detailed:

• Enzyme: Accepted name of the molecule, according to the internationally adopted nomenclature. Bibliographical references. (Further reading: see the section "Nomenclature" in the article "Homing endonuclease
  Homing endonuclease
  The homing endonucleases are a type of restriction enzymes typically encoded by introns or inteins. They act on the cellular DNA of the cells that synthesize them, in the opposite alleles of the genes that encode them.- Origin and mechanism :...
  
  ".)
• SF (Structural family): Any of the four established families for this kind of proteins, based in their shared structural motif
  Structural motif
  In a chain-like biological molecule, such as a protein or nucleic acid, a structural motif is a supersecondary structure, which appears also in a variety of other molecules...
  
  s: HI: LAGLIDADG family – HII: GIY-YIG family – HIII: H-N-H family – HIV: His-Cys box family. (Further reading: see the section "Structural families" in the article "Homing endonuclease
  Homing endonuclease
  The homing endonucleases are a type of restriction enzymes typically encoded by introns or inteins. They act on the cellular DNA of the cells that synthesize them, in the opposite alleles of the genes that encode them.- Origin and mechanism :...
  
  ".)
• PDB code: Code used to identify the structure of a protein in the PDB
  Protein Data Bank
  The Protein Data Bank is a repository for the 3-D structural data of large biological molecules, such as proteins and nucleic acids....
  
   database.
• Source: Organism that naturally produces the enzyme.
• D: Biological domain
  Domain (biology)
  In biological taxonomy, a domain is the highest taxonomic rank of organisms, higher than a kingdom. According to the three-domain system of Carl Woese, introduced in 1990, the Tree of Life consists of three domains: Archaea, Bacteria and Eukarya...
  
   of the source: A: archaea
  Archaea
  The Archaea are a group of single-celled microorganisms. A single individual or species from this domain is called an archaeon...
  
   – B: bacteria
  Bacteria
  Bacteria are a large domain of prokaryotic microorganisms. Typically a few micrometres in length, bacteria have a wide range of shapes, ranging from spheres to rods and spirals...
  
   – E: eukarya.
• SCL: Subcelullar location: chloro: chloroplast
  Chloroplast
  Chloroplasts are organelles found in plant cells and other eukaryotic organisms that conduct photosynthesis. Chloroplasts capture light energy to conserve free energy in the form of ATP and reduce NADP to NADPH through a complex set of processes called photosynthesis.Chloroplasts are green...
  
   – chrm: chromosomal
  Chromosome
  A chromosome is an organized structure of DNA and protein found in cells. It is a single piece of coiled DNA containing many genes, regulatory elements and other nucleotide sequences. Chromosomes also contain DNA-bound proteins, which serve to package the DNA and control its functions.Chromosomes...
  
   – mito: mitochondrial – nuclear: extrachromosomal nuclear
  Extrachromosomal DNA
  Extrachromosomal DNA is DNA located or maintained in a cell apart from the chromosomes....
  
   – phage: bacteriophage
  Bacteriophage
  A bacteriophage is any one of a number of viruses that infect bacteria. They do this by injecting genetic material, which they carry enclosed in an outer protein capsid...
  
  .
• Recognition sequence
  Recognition sequence
  The recognition sequence, sometimes also referred to as recognition site, of any DNA-binding protein motif that exhibits binding specificity, refers to the DNA sequence , to which the domain is specific...
  
  : Sequence of DNA recognized by the enzyme. The enzyme is specifically bound to this sequence.
• Cut: Cutting site and products of the cut. Both the recognition sequence and the cutting site match usually, but sometimes the cutting site can be dozens of nucleotides away from the recognition site.

Enzyme	SF	PDB code	Source	D	SCL	Recognition sequence Recognition sequence The recognition sequence, sometimes also referred to as recognition site, of any DNA-binding protein motif that exhibits binding specificity, refers to the DNA sequence , to which the domain is specific...	Cut
I-AniI	HI	1P8K	Aspergillus nidulans Aspergillus nidulans Aspergillus nidulans is one of many species of filamentous fungi in the phylum Ascomycota...	E	mito	5' TTGAGGAGGTTTCTCTGTAAATAA 3' AACTCCTCCAAAGAGACATTTATT	5' ---TTGAGGAGGTTTC TCTGTAAATAA--- 3' 3' ---AACTCCTCC AAAGAGACATTTATT--- 5'
I-CeuI	HI	2EX5	Chlamydomonas eugametos	E	chloro Chloroplast Chloroplasts are organelles found in plant cells and other eukaryotic organisms that conduct photosynthesis. Chloroplasts capture light energy to conserve free energy in the form of ATP and reduce NADP to NADPH through a complex set of processes called photosynthesis.Chloroplasts are green...	5' TAACTATAACGGTCCTAAGGTAGCGA 3' ATTGATATTGCCAGGATTCCATCGCT	5' ---TAACTATAACGGTCCTAA GGTAGCGA--- 3' 3' ---ATTGATATTGCCAG GATTCCATCGCT--- 5'
I-ChuI	HI		Chlamydomonas humicola	E	chloro Chloroplast Chloroplasts are organelles found in plant cells and other eukaryotic organisms that conduct photosynthesis. Chloroplasts capture light energy to conserve free energy in the form of ATP and reduce NADP to NADPH through a complex set of processes called photosynthesis.Chloroplasts are green...	5' GAAGGTTTGGCACCTCGATGTCGGCTCATC 3' CTTCCAAACCGTGGAGCTACAGCCGAGTAG	5' ---GAAGGTTTGGCACCTCG ATGTCGGCTCATC--- 3' 3' ---CTTCCAAACCGTG GAGCTACAGCCGAGTAG--- 5'
I-CpaI	HI		Chlamydomonas pallidostigmata	E	chloro Chloroplast Chloroplasts are organelles found in plant cells and other eukaryotic organisms that conduct photosynthesis. Chloroplasts capture light energy to conserve free energy in the form of ATP and reduce NADP to NADPH through a complex set of processes called photosynthesis.Chloroplasts are green...	5' CGATCCTAAGGTAGCGAAATTCA 3' GCTAGGATTCCATCGCTTTAAGT	5' ---CGATCCTAAGGTAGCGAA ATTCA--- 3' 3' ---GCTAGGATTCCATC GCTTTAAGT--- 5'
I-CpaII	HI		Chlamydomonas pallidostigmata	E	chloro Chloroplast Chloroplasts are organelles found in plant cells and other eukaryotic organisms that conduct photosynthesis. Chloroplasts capture light energy to conserve free energy in the form of ATP and reduce NADP to NADPH through a complex set of processes called photosynthesis.Chloroplasts are green...	5' CCCGGCTAACTCTGTGCCAG 3' GGGCCGATTGAGACACGGTC	5' ---CCCGGCTAACTC TGTGCCAG--- 3' 5' ---GGGCCGAT TGAGACACGGTC--- 3'
I-CreI I-CreI I-CreI is a homing endonuclease whose gene was first discovered in the chloroplast genome of Chlamydomonas reinhardtii, a species of unicellular green algae. It is named for the facts that: it resides in an Intron; it was isolated from Clamydomonas reinhardtii; it was the first such gene isolated...	HI	1BP7	Chlamydomonas reinhardtii Chlamydomonas reinhardtii Chlamydomonas reinhardtii is a single celled green alga about 10 micrometres in diameter that swims with two flagella. They have a cell wall made of hydroxyproline-rich glycoproteins, a large cup-shaped chloroplast, a large pyrenoid, and an "eyespot" that senses light.Although widely distributed...	E	chloro Chloroplast Chloroplasts are organelles found in plant cells and other eukaryotic organisms that conduct photosynthesis. Chloroplasts capture light energy to conserve free energy in the form of ATP and reduce NADP to NADPH through a complex set of processes called photosynthesis.Chloroplasts are green...	5' CTGGGTTCAAAACGTCGTGAGACAGTTTGG 3' GACCCAAGTTTTGCAGCACTCTGTCAAACC	5' ---CTGGGTTCAAAACGTCGTGA GACAGTTTGG--- 3' 3' ---GACCCAAGTTTTGCAG CACTCTGTCAAACC--- 5'
I-DmoI	HI	1B24	Desulfurococcus mobilis	A Archaea The Archaea are a group of single-celled microorganisms. A single individual or species from this domain is called an archaeon...	chrm Chromosome A chromosome is an organized structure of DNA and protein found in cells. It is a single piece of coiled DNA containing many genes, regulatory elements and other nucleotide sequences. Chromosomes also contain DNA-bound proteins, which serve to package the DNA and control its functions.Chromosomes...	5' ATGCCTTGCCGGGTAAGTTCCGGCGCGCAT 3' TACGGAACGGCCCATTCAAGGCCGCGCGTA	5' ---ATGCCTTGCCGGGTAA GTTCCGGCGCGCAT--- 3' 3' ---TACGGAACGGCC CATTCAAGGCCGCGCGTA--- 5'
H-DreI		1MOW	Escherichia coli pI-DreI Escherichia coli Escherichia coli is a Gram-negative, rod-shaped bacterium that is commonly found in the lower intestine of warm-blooded organisms . Most E. coli strains are harmless, but some serotypes can cause serious food poisoning in humans, and are occasionally responsible for product recalls...	B Bacteria Bacteria are a large domain of prokaryotic microorganisms. Typically a few micrometres in length, bacteria have a wide range of shapes, ranging from spheres to rods and spirals...		5' CAAAACGTCGTAAGTTCCGGCGCG 3' GTTTTGCAGCATTCAAGGCCGCGC	5' ---CAAAACGTCGTAA GTTCCGGCGCG--- 3' 3' ---GTTTTGCAG CATTCAAGGCCGCGC--- 5'
I-HmuI	HIII	1U3E	Bacillus subtilis Bacillus subtilis Bacillus subtilis, known also as the hay bacillus or grass bacillus, is a Gram-positive, catalase-positive bacterium commonly found in soil. A member of the genus Bacillus, B. subtilis is rod-shaped, and has the ability to form a tough, protective endospore, allowing the organism to tolerate... phage SPO1	B Bacteria Bacteria are a large domain of prokaryotic microorganisms. Typically a few micrometres in length, bacteria have a wide range of shapes, ranging from spheres to rods and spirals...	phage Bacteriophage A bacteriophage is any one of a number of viruses that infect bacteria. They do this by injecting genetic material, which they carry enclosed in an outer protein capsid...	5' AGTAATGAGCCTAACGCTCAGCAA 3' TCATTACTCGGATTGCGAGTCGTT	Nicking endonuclease: * 3' ---TCATTACTCGGATTGC GAGTCGTT--- 5'
I-HmuII	HIII		Bacillus subtilis Bacillus subtilis Bacillus subtilis, known also as the hay bacillus or grass bacillus, is a Gram-positive, catalase-positive bacterium commonly found in soil. A member of the genus Bacillus, B. subtilis is rod-shaped, and has the ability to form a tough, protective endospore, allowing the organism to tolerate... phage SP82	B Bacteria Bacteria are a large domain of prokaryotic microorganisms. Typically a few micrometres in length, bacteria have a wide range of shapes, ranging from spheres to rods and spirals...	phage Bacteriophage A bacteriophage is any one of a number of viruses that infect bacteria. They do this by injecting genetic material, which they carry enclosed in an outer protein capsid...	5' AGTAATGAGCCTAACGCTCAACAA 3' TCATTACTCGGATTGCGAGTTGTT	Nicking endonuclease: * 3' ---TCATTACTCGGATTGCGAGTTGTTN35 NNNN--- 5'
I-LlaI	HIII		Lactococcus lactis Lactococcus lactis Lactococcus lactis is a Gram-positive bacterium used extensively in the production of buttermilk and cheese, but has recently also become famous as the first genetically modified organism to be used alive for the treatment of human disease. L...	B Bacteria Bacteria are a large domain of prokaryotic microorganisms. Typically a few micrometres in length, bacteria have a wide range of shapes, ranging from spheres to rods and spirals...	chrm Chromosome A chromosome is an organized structure of DNA and protein found in cells. It is a single piece of coiled DNA containing many genes, regulatory elements and other nucleotide sequences. Chromosomes also contain DNA-bound proteins, which serve to package the DNA and control its functions.Chromosomes...	5' CACATCCATAACCATATCATTTTT 3' GTGTAGGTATTGGTATAGTAAAAA	5' ---CACATCCATAA CCATATCATTTTT--- 3' 3' ---GTGTAGGTATTGGTATAGTAA AAA--- 5'
I-MsoI		1M5X	Monomastix sp. Monomastix In taxonomy, Monomastix is a genus of algae, specifically of the Monomasticaceae.-Scientific databases:* * *...	E		5' CTGGGTTCAAAACGTCGTGAGACAGTTTGG 3' GACCCAAGTTTTGCAGCACTCTGTCAAACC	5' ---CTGGGTTCAAAACGTCGTGA GACAGTTTGG--- 3' 3' ---GACCCAAGTTTTGCAG CACTCTGTCAAACC--- 5'
PI-PfuI		1DQ3	Pyrococcus furiosus Vc1 Pyrococcus furiosus Pyrococcus furiosus is an extremophilic species of Archaea. It can be classified as a hyperthermophile because it thrives best under extremely high temperatures—higher than those preferred of a thermophile...	A Archaea The Archaea are a group of single-celled microorganisms. A single individual or species from this domain is called an archaeon...		5' GAAGATGGGAGGAGGGACCGGACTCAACTT 3' CTTCTACCCTCCTCCCTGGCCTGAGTTGAA	5' ---GAAGATGGGAGGAGGG ACCGGACTCAACTT--- 3' 3' ---CTTCTACCCTCC TCCCTGGCCTGAGTTGAA--- 5'
PI-PkoII		2CW7	Pyrococcus kodakaraensis KOD1	A Archaea The Archaea are a group of single-celled microorganisms. A single individual or species from this domain is called an archaeon...		5' CAGTACTACGGTTAC 3' GTCATGATGCCAATG	5' ---CAGTACTACG GTTAC--- 3' 3' ---GTCATG ATGCCAATG--- 5'
I-PorI	HIII		Pyrobaculum organotrophum	A Archaea The Archaea are a group of single-celled microorganisms. A single individual or species from this domain is called an archaeon...	chrm Chromosome A chromosome is an organized structure of DNA and protein found in cells. It is a single piece of coiled DNA containing many genes, regulatory elements and other nucleotide sequences. Chromosomes also contain DNA-bound proteins, which serve to package the DNA and control its functions.Chromosomes...	5' GCGAGCCCGTAAGGGTGTGTACGGG 3' CGCTCGGGCATTCCCACACATGCCC	5' ---GCGAGCCCGTAAGGGT GTGTACGGG--- 3' 3' ---CGCTCGGGCATT CCCACACATGCCC--- 5'
I-PpoI	HIV	1EVX	Physarum polycephalum Physarum polycephalum Physarum polycephalum belongs to the supergroup Amoebozoa, phylum Mycetozoa, and class Myxogastria. P. polycephalum, often referred to as the “many-headed slime,” is a slime mold that inhabits shady, cool, moist areas, such as decaying leaves and logs...	E	nuclear Extrachromosomal DNA Extrachromosomal DNA is DNA located or maintained in a cell apart from the chromosomes....	5' TAACTATGACTCTCTTAAGGTAGCCAAAT 3' ATTGATACTGAGAGAATTCCATCGGTTTA	5' ---TAACTATGACTCTCTTAA GGTAGCCAAAT--- 3' 3' ---ATTGATACTGAGAG AATTCCATCGGTTTA--- 5'
PI-PspI	HI		Pyrococcus sp. Pyrococcus In taxonomy, Pyrococcus is a genus of the Thermococcaceae.- Description and significance :Pyrococcus has similar characteristics of other archaea such as Archaeoglobus, Thermoautotrophican, and Methanococcus in the respect that they are all thermophilic and anaerobic...	A Archaea The Archaea are a group of single-celled microorganisms. A single individual or species from this domain is called an archaeon...	chrm Chromosome A chromosome is an organized structure of DNA and protein found in cells. It is a single piece of coiled DNA containing many genes, regulatory elements and other nucleotide sequences. Chromosomes also contain DNA-bound proteins, which serve to package the DNA and control its functions.Chromosomes...	5' TGGCAAACAGCTATTATGGGTATTATGGGT 3' ACCGTTTGTCGATAATACCCATAATACCCA	5' ---TGGCAAACAGCTATTAT GGGTATTATGGGT--- 3' 3' ---ACCGTTTGTCGAT AATACCCATAATACCCA--- 5'
I-ScaI	HI		Saccharomyces capensis	E	mito	5' TGTCACATTGAGGTGCACTAGTTATTAC 3' ACAGTGTAACTCCACGTGATCAATAATG	5' ---TGTCACATTGAGGTGCACT AGTTATTAC--- 3' 3' ---ACAGTGTAACTCCAC GTGATCAATAATG--- 5'
I-SceI	HI	1R7M	Saccharomyces cerevisiae Saccharomyces cerevisiae Saccharomyces cerevisiae is a species of yeast. It is perhaps the most useful yeast, having been instrumental to baking and brewing since ancient times. It is believed that it was originally isolated from the skin of grapes...	E	mito	5' AGTTACGCTAGGGATAACAGGGTAATATAG 3' TCAATGCGATCCCTATTGTCCCATTATATC	5' ---AGTTACGCTAGGGATAA CAGGGTAATATAG--- 3' 3' ---TCAATGCGATCCC TATTGTCCCATTATATC--- 5'
PI-SceI	HI	1VDE	Saccharomyces cerevisiae Saccharomyces cerevisiae Saccharomyces cerevisiae is a species of yeast. It is perhaps the most useful yeast, having been instrumental to baking and brewing since ancient times. It is believed that it was originally isolated from the skin of grapes...	E		5' ATCTATGTCGGGTGCGGAGAAAGAGGTAATGAAATGGCA 3' TAGATACAGCCCACGCCTCTTTCTCCATTACTTTACCGT	5' ---ATCTATGTCGGGTGC GGAGAAAGAGGTAATGAAATGGCA--- 3' 3' ---TAGATACAGCC CACGCCTCTTTCTCCATTACTTTACCGT--- 5'
I-SceII	HI		Saccharomyces cerevisiae Saccharomyces cerevisiae Saccharomyces cerevisiae is a species of yeast. It is perhaps the most useful yeast, having been instrumental to baking and brewing since ancient times. It is believed that it was originally isolated from the skin of grapes...	E	mito	5' TTTTGATTCTTTGGTCACCCTGAAGTATA 3' AAAACTAAGAAACCAGTGGGACTTCATAT	5' ---TTTTGATTCTTTGGTCACCC TGAAGTATA--- 3' 3' ---AAAACTAAGAAACCAG TGGGACTTCATAT--- 5'
I-SecIII	HI		Saccharomyces cerevisiae Saccharomyces cerevisiae Saccharomyces cerevisiae is a species of yeast. It is perhaps the most useful yeast, having been instrumental to baking and brewing since ancient times. It is believed that it was originally isolated from the skin of grapes...	E	mito	5' ATTGGAGGTTTTGGTAACTATTTATTACC 3' TAACCTCCAAAACCATTGATAAATAATGG	5' ---ATTGGAGGTTTTGGTAAC TATTTATTACC--- 3' 3' ---TAACCTCCAAAACC ATTGATAAATAATGG--- 5'
I-SceIV	HI		Saccharomyces cerevisiae Saccharomyces cerevisiae Saccharomyces cerevisiae is a species of yeast. It is perhaps the most useful yeast, having been instrumental to baking and brewing since ancient times. It is believed that it was originally isolated from the skin of grapes...	E	mito	5' TCTTTTCTCTTGATTAGCCCTAATCTACG 3' AGAAAAGAGAACTAATCGGGATTAGATGC	5' ---TCTTTTCTCTTGATTA GCCCTAATCTACG--- 3' 3' ---AGAAAAGAGAAC TAATCGGGATTAGATGC--- 5'
I-SceV	HIII		Saccharomyces cerevisiae Saccharomyces cerevisiae Saccharomyces cerevisiae is a species of yeast. It is perhaps the most useful yeast, having been instrumental to baking and brewing since ancient times. It is believed that it was originally isolated from the skin of grapes...	E	mito	5' AATAATTTTCTTCTTAGTAATGCC 3' TTATTAAAAGAAGAATCATTACGG	5' ---AATAATTTTCT TCTTAGTAATGCC--- 3' 3' ---TTATTAAAAGAAGAATCATTA CGG--- 5'
I-SceVI	HIII		Saccharomyces cerevisiae Saccharomyces cerevisiae Saccharomyces cerevisiae is a species of yeast. It is perhaps the most useful yeast, having been instrumental to baking and brewing since ancient times. It is believed that it was originally isolated from the skin of grapes...	E	mito	5' GTTATTTAATGTTTTAGTAGTTGG 3' CAATAAATTACAAAATCATCAACC	5' ---GTTATTTAATG TTTTAGTAGTTGG--- 3' 3' ---CAATAAATTACAAAATCATCA ACC--- 5'
I-SceVII	HI		Saccharomyces cerevisiae Saccharomyces cerevisiae Saccharomyces cerevisiae is a species of yeast. It is perhaps the most useful yeast, having been instrumental to baking and brewing since ancient times. It is believed that it was originally isolated from the skin of grapes...	E	mito	5' TGTCACATTGAGGTGCACTAGTTATTAC 3' ACAGTGTAACTCCACGTGATCAATAATG	Unknown **
I-Ssp6803I		2OST	Synechocystis sp. PCC 6803 Synechocystis Synechocystis sp. PCC6803 is a freshwater cyanobacterium capable of both phototrophic growth by oxygenic photosynthesis in sunlight and heterotrophic growth by glycolysis and oxidative phosphorylation during dark periods...	B Bacteria Bacteria are a large domain of prokaryotic microorganisms. Typically a few micrometres in length, bacteria have a wide range of shapes, ranging from spheres to rods and spirals...		5' GTCGGGCTCATAACCCGAA 3' CAGCCCGAGTATTGGGCTT	5' ---GTCGGGCT CATAACCCGAA--- 3' 3' ---CAGCCCGAGTA TTGGGCTT--- 5'
I-TevI	HII	1I3J	Escherichia coli Escherichia coli Escherichia coli is a Gram-negative, rod-shaped bacterium that is commonly found in the lower intestine of warm-blooded organisms . Most E. coli strains are harmless, but some serotypes can cause serious food poisoning in humans, and are occasionally responsible for product recalls... phage T4	B Bacteria Bacteria are a large domain of prokaryotic microorganisms. Typically a few micrometres in length, bacteria have a wide range of shapes, ranging from spheres to rods and spirals...	phage Bacteriophage A bacteriophage is any one of a number of viruses that infect bacteria. They do this by injecting genetic material, which they carry enclosed in an outer protein capsid...	5' AGTGGTATCAACGCTCAGTAGATG 3' TCACCATAGT TGCGAGTCATCTAC	5' ---AGTGGTATCAAC GCTCAGTAGATG--- 3' 3' ---TCACCATAGT TGCGAGTCATCTAC--- 5'
I-TevII	HII		Escherichia coli Escherichia coli Escherichia coli is a Gram-negative, rod-shaped bacterium that is commonly found in the lower intestine of warm-blooded organisms . Most E. coli strains are harmless, but some serotypes can cause serious food poisoning in humans, and are occasionally responsible for product recalls... phage T4	B Bacteria Bacteria are a large domain of prokaryotic microorganisms. Typically a few micrometres in length, bacteria have a wide range of shapes, ranging from spheres to rods and spirals...	phage Bacteriophage A bacteriophage is any one of a number of viruses that infect bacteria. They do this by injecting genetic material, which they carry enclosed in an outer protein capsid...	5' GCTTATGAGTATGAAGTGAACACGTTATTC 3' CGAATACTCATACTTCACTTGTGCAATAAG	5' ---GCTTATGAGTATGAAGTGAACACGT TATTC--- 3' 3' ---CGAATACTCATACTTCACTTGTG CAATAAG--- 5'
I-TevIII	HIII		Escherichia coli Escherichia coli Escherichia coli is a Gram-negative, rod-shaped bacterium that is commonly found in the lower intestine of warm-blooded organisms . Most E. coli strains are harmless, but some serotypes can cause serious food poisoning in humans, and are occasionally responsible for product recalls... phage RB3	B Bacteria Bacteria are a large domain of prokaryotic microorganisms. Typically a few micrometres in length, bacteria have a wide range of shapes, ranging from spheres to rods and spirals...	phage Bacteriophage A bacteriophage is any one of a number of viruses that infect bacteria. They do this by injecting genetic material, which they carry enclosed in an outer protein capsid...	5' TATGTATCTTTTGCGTGTACCTTTAACTTC 3' ATACATAGAAAACGCACATGGAAATTGAAG	5' ---T ATGTATCTTTTGCGTGTACCTTTAACTTC--- 3' 3' ---AT ACATAGAAAACGCACATGGAAATTGAAG--- 5'
PI-TliI	HI		Thermococcus litoralis Thermococcus litoralis Thermococcus litoralis is a species of archaea.-Location:Thermococcus litoralis grows near and around deep-sea smoker vents.-Reproduction:...	A Archaea The Archaea are a group of single-celled microorganisms. A single individual or species from this domain is called an archaeon...	chrm Chromosome A chromosome is an organized structure of DNA and protein found in cells. It is a single piece of coiled DNA containing many genes, regulatory elements and other nucleotide sequences. Chromosomes also contain DNA-bound proteins, which serve to package the DNA and control its functions.Chromosomes...	5' TAYGCNGAYACNGACGGYTTYT 3' ATRCGNCTRTGNCTGCCTAARA	5' ---TAYGCNGAYACNGACGG YTTYT--- 3' 3' ---ATRCGNCTRTGNC TGCCTAARA--- 5'
PI-TliII	HI		Thermococcus litoralis Thermococcus litoralis Thermococcus litoralis is a species of archaea.-Location:Thermococcus litoralis grows near and around deep-sea smoker vents.-Reproduction:...	A Archaea The Archaea are a group of single-celled microorganisms. A single individual or species from this domain is called an archaeon...	chrm Chromosome A chromosome is an organized structure of DNA and protein found in cells. It is a single piece of coiled DNA containing many genes, regulatory elements and other nucleotide sequences. Chromosomes also contain DNA-bound proteins, which serve to package the DNA and control its functions.Chromosomes...	5' AAATTGCTTGCAAACAGCTATTACGGCTAT 3' TTTAACGAACGTTTGTCGATAATGCCGATA	Unknown **
I-Tsp061I		2DCH	Thermoproteus sp. IC-061 Thermoproteus In taxonomy, Thermoproteus is a genus of the Thermoproteaceae.These prokaryotes are thermophilic sulphur-dependent organisms related to the genera Sulfolobus, Pyrodictium and Desulfurococcus...	A Archaea The Archaea are a group of single-celled microorganisms. A single individual or species from this domain is called an archaeon...		5' CTTCAGTATGCCCCGAAAC 3' GAAGTCATACGGGGCTTTG	5' ---CTTCAGTAT GCCCCGAAAC--- 3' 3' ---GAAGT CATACGGGGCTTTG--- 5'
I-Vdi141I		3E54	Vulcanisaeta distributa IC-141	A Archaea The Archaea are a group of single-celled microorganisms. A single individual or species from this domain is called an archaeon...		5' CCTGACTCTCTTAAGGTAGCCAAA 3' GGACTGAGAGAATTCCATCGGTTT	5' ---CCTGACTCTCTTAA GGTAGCCAAA--- 3' 3' ---GGACTGAG AGAATTCCATCGGTTT--- 5'

*: Nicking endonuclease: These enzymes cut only one DNA strand, leaving the other strand untouched.

**: Unknown cutting site: Researchers have not been able to determine the exact cutting site of these enzymes yet.

See also

• List of restriction enzyme cutting sites.
• Homing endonuclease
  Homing endonuclease
  The homing endonucleases are a type of restriction enzymes typically encoded by introns or inteins. They act on the cellular DNA of the cells that synthesize them, in the opposite alleles of the genes that encode them.- Origin and mechanism :...
  
  .
• Restriction enzyme
  Restriction enzyme
  A Restriction Enzyme is an enzyme that cuts double-stranded DNA at specific recognition nucleotide sequences known as restriction sites. Such enzymes, found in bacteria and archaea, are thought to have evolved to provide a defense mechanism against invading viruses...
  
  .
• Intron
  Intron
  An intron is any nucleotide sequence within a gene that is removed by RNA splicing to generate the final mature RNA product of a gene. The term intron refers to both the DNA sequence within a gene, and the corresponding sequence in RNA transcripts. Sequences that are joined together in the final...
  
  s and intein
  Intein
  An intein is a segment of a protein that is able to excise itself and rejoin the remaining portions with a peptide bond. Inteins have also been called "protein introns"....
  
  s.
• Intragenomic conflict: Homing endonuclease genes.
• I-CreI homing endonuclease
  I-CreI
  I-CreI is a homing endonuclease whose gene was first discovered in the chloroplast genome of Chlamydomonas reinhardtii, a species of unicellular green algae. It is named for the facts that: it resides in an Intron; it was isolated from Clamydomonas reinhardtii; it was the first such gene isolated...
  
  .
• Isoschizomer
  Isoschizomer
  Isoschizomers are pairs of restriction enzymes specific to the same recognition sequence. For example, Sph I and Bbu I are isoschizomers of each other. The first enzyme to recognize and cut a given sequence is known as the prototype, all subsequent enzymes that recognize and cut that sequence...
  
  .
• Detailed articles about certain restriction enzymes: EcoRI
  EcoRI
  EcoRI is an endonuclease enzyme isolated from strains of E. coli, and is part of the restriction modification system.In molecular biology it is used as a restriction enzyme. It creates sticky ends with 5' end overhangs...
  
  , HindIII
  HindIII
  HindIII is a type II site-specific deoxyribonuclease restriction enzyme isolated from Haemophilus influenzae that cleaves the palindromic DNA sequence AAGCTT in the presence of the cofactor Mg2+ via hydrolysis....
  
  , BglII
  BglII
  BglII is a type II restriction endonuclease enzyme isolated from certain strains of Bacillus globigii. The principal function of restriction enzymes is the protection of the host genome against foreign DNA but they may also have some involvement in recombination and transposition...
  
  .

Information sources

Databases and lists of restriction enzymes:

• Very comprehensive database of restriction enzymes supported by New England Biolabs©. It includes all kind of biological, structural, kinetical and commercial information about thousands of enzymes. Also includes related literature for every molecule:
• Database of inteins, hosted by New England Biolabs©. .
• Detailed information for biochemical experiments:
• Alphabetical list of enzymes and their restriction sites:
• General information about restriction sites and biochemical conditions for restriction reactions:

Databases of proteins:

• Database of protein structures, solved at atomic resolution:
• Databases of proteins: