Rudivirus
Encyclopedia
The Rudivirus are unenveloped, stiff-rod-shaped viruses with linear dsDNA genomes, that infect hyperthermophilic archaea
of the kingdom Crenarchaeota
.
The study of crenarchaeal viruses is still incipient. Our knowledge of their biology and basic molecular processes, including infection, virus-host interactions, DNA replication and packaging, as well as transcription regulation, is somewhat limited.
Rudivirus are promising candidates to become a general model for detailed studies of archaeal virus biology. These are indeed easily maintained under laboratory conditions and can be obtained in sufficient yields, unlike many other archaeal viruses.
The family name derives from the Latin
rudis, thin rod, referring to the virion shape.
The two main species, viruses SIRV1 and SIRV2, were produced by colony-cloned Sulfolobus islandicus
strains. The two strains were isolated from samples taken in 1994 from different solfataric fields in Iceland
, the Kverkfjöll
and Hveragerdi which are separated by a distance of 250 km. These Icelandic solfataric acidic hot springs reach a temperature of 88°C and pH 2.5. As for its stability in many hosts, SIRV2 is a better candidate for the type species than SIRV1 .
Acidianus
rod-shaped virus 1, ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli
, Italy
in 2005 .
The Stygiolobus
rod-shaped virus, SRV, which infects a hyperthermophilic Stygiolobus species, was isolated from a hot spring in the Azores
, Portugal
in 2008 .
formed by dsDNA and the major structural protein, with plugs at each end to which three tail fibers are anchored. These tail fibers appear to be involved in adsorption
onto the host cell surface and are formed by one of the minor structural proteins.
Both Sulfolobus islandicus
rod-shaped viruses are stiff rods of about 23 nm in width, but differing in length — SIRV1 is about 830 nm and SIRV2 is about 900 nm long. They present a central channel of approx. 6 nm that encapsidates the DNA genome. At each terminus of the rod there is a plug of approx. 48 nm in length and 6 nm in diameter that fills the terminal portion of the cavity, together with three tail fibres of approx. 28 nm in length.
Acidianus
rod-shaped virus 1 is 610 nm long and 22 nm wide, also has the three tail fibers protruding at each end and the same central channel encapsidating the genome.
The Stygiolobus
rod-shaped virus displays a similar rod-shaped morphology, sizing 702 nm by 22 nm.
The Sulfolobus
rudiviruses size up to 32.3 kbp for SIRV1 and 35.8 kbp for SIRV2, with inverted terminal repeats of 2029 bp at the ends of the linear genome. The G+C content
of both genomes is extremely low, of only 25%, whereas the genome of Sulfolobus solfataricus
(the sequenced genome closest to the virus host) hits 37%.
The genome sequence and composition of ARV1 differs strongly from those of the Sulfolobus
rudiviruses. ARV1 has a genome of 24,655 bp, including 1365 bp inverted terminal repeats at both ends.
SRV shows sufficient genomical differences from the other rudiviruses to warrant its classification as a novel species. Its genome totals 28,096 bp and presents inverted terminal repeats of 1,030 bp.
Although the sequences of the inverted terminal repeats of the rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction
resolvase and DNA replication
.
al patterns of the rudiviruses SIRV1 and SIRV2 are relatively simple, with few temporal expression differences . Contrastingly, at least 10% of its genes were predicted to have of different DNA binding motifs in the proteins they code and were assigned to be putative transcriptional regulators
. A high proportion of viral genes coding for DNA binding proteins with the ribbon-helix-helix (RHH) DNA binding motifs has been suggested. The abundance of genes coding for proteins belonging to the RHH superfamily present in the genomes of crenarchaea and their viruses could underline the important role of these proteins in host and viral gene transcription regulation
under harsh conditions.
Protein SvtR was the first crenarchaeal RHH regulator characterized in details and also the first viral coded transcriptional regulators
within the Archaeal domain. It strongly represses the transcription of the minor structural protein and, to a lesser extent, of its own gene. The structure is very similar to that of bacterial RHH proteins despite the low sequence similarity, such as CopG, a bacterial plasmid copy number control regulator.
A Sulfolobus islandicus
coded transcription activator, Sta1, as also been shown to activate transcription of several viral genes .
rod-shaped virus 2 (SIRV2) is a lytic virus that kills the host cell as a consequence of elaborated mechanisms orchestrated by the virus. Massive degradation of the host chromosomes occurs because of virus infection and virion assembly occurs in the cytoplasm
. Virions are released from the host cell through a mechanism that involves the formation of specific cellular structures .
Archaea
The Archaea are a group of single-celled microorganisms. A single individual or species from this domain is called an archaeon...
of the kingdom Crenarchaeota
Crenarchaeota
In taxonomy, the Crenarchaeota has been classified as either a phylum of the Archaea kingdom or a kingdom of its own...
.
The study of crenarchaeal viruses is still incipient. Our knowledge of their biology and basic molecular processes, including infection, virus-host interactions, DNA replication and packaging, as well as transcription regulation, is somewhat limited.
Rudivirus are promising candidates to become a general model for detailed studies of archaeal virus biology. These are indeed easily maintained under laboratory conditions and can be obtained in sufficient yields, unlike many other archaeal viruses.
The family name derives from the Latin
Latin
Latin is an Italic language originally spoken in Latium and Ancient Rome. It, along with most European languages, is a descendant of the ancient Proto-Indo-European language. Although it is considered a dead language, a number of scholars and members of the Christian clergy speak it fluently, and...
rudis, thin rod, referring to the virion shape.
Taxonomy
- Main species
- Sulfolobus islandicusSulfolobusSulfolobus is a genus of microorganism in the family Sulfolobaceae. It belongs to the archea domain.Sulfolobus species grow in volcanic springs with optimal growth occurring at pH 2-3 and temperatures of 75-80 °C, making them acidophiles and thermophiles respectively...
rod-shaped virus 1, SIRV1; genome sequence accession no. AJ414696. - Sulfolobus islandicusSulfolobusSulfolobus is a genus of microorganism in the family Sulfolobaceae. It belongs to the archea domain.Sulfolobus species grow in volcanic springs with optimal growth occurring at pH 2-3 and temperatures of 75-80 °C, making them acidophiles and thermophiles respectively...
rod-shaped virus 2, SIRV2; genome sequence accession no. AJ344259.
- Sulfolobus islandicus
- Other species
- AcidianusAcidianusIn taxonomy, Acidianus is a genus of the Sulfolobaceae.-External links:...
rod-shaped virus 1, ARV1; genome sequence accession no. AJ875026. - StygiolobusStygiolobusIn taxonomy, Stygiolobus is a genus of the Sulfolobaceae.-External links:...
rod-shaped virus, SRV, genome sequence accession no. FM164764.
- Acidianus
The two main species, viruses SIRV1 and SIRV2, were produced by colony-cloned Sulfolobus islandicus
Sulfolobus
Sulfolobus is a genus of microorganism in the family Sulfolobaceae. It belongs to the archea domain.Sulfolobus species grow in volcanic springs with optimal growth occurring at pH 2-3 and temperatures of 75-80 °C, making them acidophiles and thermophiles respectively...
strains. The two strains were isolated from samples taken in 1994 from different solfataric fields in Iceland
Iceland
Iceland , described as the Republic of Iceland, is a Nordic and European island country in the North Atlantic Ocean, on the Mid-Atlantic Ridge. Iceland also refers to the main island of the country, which contains almost all the population and almost all the land area. The country has a population...
, the Kverkfjöll
Kverkfjöll
The mountain range Kverkfjöll is situated on the north-eastern border of the glacier Vatnajökull in Iceland. With their glacier Kverkjökull, they are to be found between the Vatnajökull and the Dyngjufjöll . The mountains are still active volcanoes...
and Hveragerdi which are separated by a distance of 250 km. These Icelandic solfataric acidic hot springs reach a temperature of 88°C and pH 2.5. As for its stability in many hosts, SIRV2 is a better candidate for the type species than SIRV1 .
Acidianus
Acidianus
In taxonomy, Acidianus is a genus of the Sulfolobaceae.-External links:...
rod-shaped virus 1, ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli
Pozzuoli
Pozzuoli is a city and comune of the province of Naples, in the Italian region of Campania. It is the main city of the Phlegrean peninsula.-History:Pozzuoli began as the Greek colony of Dicaearchia...
, Italy
Italy
Italy , officially the Italian Republic languages]] under the European Charter for Regional or Minority Languages. In each of these, Italy's official name is as follows:;;;;;;;;), is a unitary parliamentary republic in South-Central Europe. To the north it borders France, Switzerland, Austria and...
in 2005 .
The Stygiolobus
Stygiolobus
In taxonomy, Stygiolobus is a genus of the Sulfolobaceae.-External links:...
rod-shaped virus, SRV, which infects a hyperthermophilic Stygiolobus species, was isolated from a hot spring in the Azores
Azores
The Archipelago of the Azores is composed of nine volcanic islands situated in the middle of the North Atlantic Ocean, and is located about west from Lisbon and about east from the east coast of North America. The islands, and their economic exclusion zone, form the Autonomous Region of the...
, Portugal
Portugal
Portugal , officially the Portuguese Republic is a country situated in southwestern Europe on the Iberian Peninsula. Portugal is the westernmost country of Europe, and is bordered by the Atlantic Ocean to the West and South and by Spain to the North and East. The Atlantic archipelagos of the...
in 2008 .
Structure
Virions are non-enveloped, consisting of a tube-like superhelixSuperhelix
A superhelix is a molecular structure in which a helix is itself coiled into a helix. This is significant to both proteins and genetic material, such as overwound circular DNA....
formed by dsDNA and the major structural protein, with plugs at each end to which three tail fibers are anchored. These tail fibers appear to be involved in adsorption
Adsorption
Adsorption is the adhesion of atoms, ions, biomolecules or molecules of gas, liquid, or dissolved solids to a surface. This process creates a film of the adsorbate on the surface of the adsorbent. It differs from absorption, in which a fluid permeates or is dissolved by a liquid or solid...
onto the host cell surface and are formed by one of the minor structural proteins.
Both Sulfolobus islandicus
Sulfolobus
Sulfolobus is a genus of microorganism in the family Sulfolobaceae. It belongs to the archea domain.Sulfolobus species grow in volcanic springs with optimal growth occurring at pH 2-3 and temperatures of 75-80 °C, making them acidophiles and thermophiles respectively...
rod-shaped viruses are stiff rods of about 23 nm in width, but differing in length — SIRV1 is about 830 nm and SIRV2 is about 900 nm long. They present a central channel of approx. 6 nm that encapsidates the DNA genome. At each terminus of the rod there is a plug of approx. 48 nm in length and 6 nm in diameter that fills the terminal portion of the cavity, together with three tail fibres of approx. 28 nm in length.
Acidianus
Acidianus
In taxonomy, Acidianus is a genus of the Sulfolobaceae.-External links:...
rod-shaped virus 1 is 610 nm long and 22 nm wide, also has the three tail fibers protruding at each end and the same central channel encapsidating the genome.
The Stygiolobus
Stygiolobus
In taxonomy, Stygiolobus is a genus of the Sulfolobaceae.-External links:...
rod-shaped virus displays a similar rod-shaped morphology, sizing 702 nm by 22 nm.
Genome
The rudiviral genome is composed of linear dsDNA and ranges from of 24 kb (ARV1) to 35 kb (SIRV2).The two strands of the linear genomes are covalently linked and, at both ends of the genome, there are inverted terminal repeats.The Sulfolobus
Sulfolobus
Sulfolobus is a genus of microorganism in the family Sulfolobaceae. It belongs to the archea domain.Sulfolobus species grow in volcanic springs with optimal growth occurring at pH 2-3 and temperatures of 75-80 °C, making them acidophiles and thermophiles respectively...
rudiviruses size up to 32.3 kbp for SIRV1 and 35.8 kbp for SIRV2, with inverted terminal repeats of 2029 bp at the ends of the linear genome. The G+C content
GC-content
In molecular biology and genetics, GC-content is the percentage of nitrogenous bases on a DNA molecule that are either guanine or cytosine . This may refer to a specific fragment of DNA or RNA, or that of the whole genome...
of both genomes is extremely low, of only 25%, whereas the genome of Sulfolobus solfataricus
Sulfolobus
Sulfolobus is a genus of microorganism in the family Sulfolobaceae. It belongs to the archea domain.Sulfolobus species grow in volcanic springs with optimal growth occurring at pH 2-3 and temperatures of 75-80 °C, making them acidophiles and thermophiles respectively...
(the sequenced genome closest to the virus host) hits 37%.
The genome sequence and composition of ARV1 differs strongly from those of the Sulfolobus
Sulfolobus
Sulfolobus is a genus of microorganism in the family Sulfolobaceae. It belongs to the archea domain.Sulfolobus species grow in volcanic springs with optimal growth occurring at pH 2-3 and temperatures of 75-80 °C, making them acidophiles and thermophiles respectively...
rudiviruses. ARV1 has a genome of 24,655 bp, including 1365 bp inverted terminal repeats at both ends.
SRV shows sufficient genomical differences from the other rudiviruses to warrant its classification as a novel species. Its genome totals 28,096 bp and presents inverted terminal repeats of 1,030 bp.
Although the sequences of the inverted terminal repeats of the rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction
Holliday junction
A Holliday junction is a mobile junction between four strands of DNA. The structure is named after Robin Holliday, who proposed it in 1964 to account for a particular type of exchange of genetic information he observed in yeast known as homologous recombination...
resolvase and DNA replication
DNA replication
DNA replication is a biological process that occurs in all living organisms and copies their DNA; it is the basis for biological inheritance. The process starts with one double-stranded DNA molecule and produces two identical copies of the molecule...
.
Transcriptional Patterns and Transcription Regulation
The transcriptionTranscription (genetics)
Transcription is the process of creating a complementary RNA copy of a sequence of DNA. Both RNA and DNA are nucleic acids, which use base pairs of nucleotides as a complementary language that can be converted back and forth from DNA to RNA by the action of the correct enzymes...
al patterns of the rudiviruses SIRV1 and SIRV2 are relatively simple, with few temporal expression differences . Contrastingly, at least 10% of its genes were predicted to have of different DNA binding motifs in the proteins they code and were assigned to be putative transcriptional regulators
Transcription factor
In molecular biology and genetics, a transcription factor is a protein that binds to specific DNA sequences, thereby controlling the flow of genetic information from DNA to mRNA...
. A high proportion of viral genes coding for DNA binding proteins with the ribbon-helix-helix (RHH) DNA binding motifs has been suggested. The abundance of genes coding for proteins belonging to the RHH superfamily present in the genomes of crenarchaea and their viruses could underline the important role of these proteins in host and viral gene transcription regulation
Transcriptional regulation
Transcriptional regulation is the change in gene expression levels by altering transcription rates. -Regulation of transcription:Regulation of transcription controls when transcription occurs and how much RNA is created...
under harsh conditions.
Protein SvtR was the first crenarchaeal RHH regulator characterized in details and also the first viral coded transcriptional regulators
Transcription factor
In molecular biology and genetics, a transcription factor is a protein that binds to specific DNA sequences, thereby controlling the flow of genetic information from DNA to mRNA...
within the Archaeal domain. It strongly represses the transcription of the minor structural protein and, to a lesser extent, of its own gene. The structure is very similar to that of bacterial RHH proteins despite the low sequence similarity, such as CopG, a bacterial plasmid copy number control regulator.
A Sulfolobus islandicus
Sulfolobus
Sulfolobus is a genus of microorganism in the family Sulfolobaceae. It belongs to the archea domain.Sulfolobus species grow in volcanic springs with optimal growth occurring at pH 2-3 and temperatures of 75-80 °C, making them acidophiles and thermophiles respectively...
coded transcription activator, Sta1, as also been shown to activate transcription of several viral genes .
Viral life cycle
Sulfolobus islandicusSulfolobus
Sulfolobus is a genus of microorganism in the family Sulfolobaceae. It belongs to the archea domain.Sulfolobus species grow in volcanic springs with optimal growth occurring at pH 2-3 and temperatures of 75-80 °C, making them acidophiles and thermophiles respectively...
rod-shaped virus 2 (SIRV2) is a lytic virus that kills the host cell as a consequence of elaborated mechanisms orchestrated by the virus. Massive degradation of the host chromosomes occurs because of virus infection and virion assembly occurs in the cytoplasm
Cytoplasm
The cytoplasm is a small gel-like substance residing between the cell membrane holding all the cell's internal sub-structures , except for the nucleus. All the contents of the cells of prokaryote organisms are contained within the cytoplasm...
. Virions are released from the host cell through a mechanism that involves the formation of specific cellular structures .