X-linked congenital stationary night blindness
Encyclopedia
X-linked congenital stationary night blindness (CSNB) is a rare X-linked non-progressive retina
l disorder. It has two forms, complete, also known as type-1 (CSNB1), and incomplete, also known as type-2 (CSNB2), depending on severity. In the complete form (CSNB1), there is no measurable rod cell
response to light, whereas this response is measurable in the incomplete form. Patients with this disorder have difficulty adapting to low light situations due to impaired photoreceptor transmission
. These patients also often have reduced visual acuity, myopia
, nystagmus, and strabismus
. CSNB1 is caused by mutations in the gene NYX
, which encodes a protein involved in retinal synapse
formation or synaptic transmission. CSNB2 is caused by mutations in the gene CACNA1F, which encodes a voltage-gated calcium channel CaV1.4.
, which is typically absent in the autosomal forms. Patients with CSNB often have impaired night vision, myopia
, reduced visual acuity
, strabismus
, and nystagmus. Individuals with the complete form of CSNB (CSNB1) have highly impaired rod
sensitivity (reduced ~300x) as well as cone
dysfunction. Patients with the incomplete form can present with either myopia or hyperopia
.
to bipolar cell
s in the retina. This is due to electroretinogram (ERG) measurements on CSNB patients which show a drastic decrease in the size of the scotopic b-wave in comparison to the a-wave, in CSNB2, or a complete loss of both in CSNB1. The a-wave is believed to represent the response of rods to visual input and remains largely unchanged in CSNB2 patients. The b-wave, however, is believed to result from electrical activity of bipolar cell
s and is decreased or non-existent in both CSNB1 and 2. CSNB1 patients also show mildly altered cone activity. Further study has demonstrated that the defects found in CSNB patients are better explained by more general defects in both the rod and cone ON-signaling pathways.
, is caused by mutations in the NYX gene
(Nyctalopin on X-chromosome), which encodes a small leucine-rich repeat
(LRR) family protein of unknown function. This protein consists of an N-terminal signal peptide and 11 LRRs (LRR1-11) flanked by cysteine-rich LRRs (LRRNT and LRRCT). At the C-terminus of the protein there is a putative GPI anchor site. Although the function of NYX is yet to be fully understood, it is believed to be located extracellularly. A naturally occurring deletion of 85 bases in NYX in some mice leads to the "nob" (no b-wave) phenotype, which is highly similar to that seen in CSNB1 patients. NYX is expressed primarily in the rod and cone cells of the retina. There are currently almost 40 known mutations in NYX associated with CSNB1, Table 1., located throughout the protein. As the function of the nyctalopin protein is unknown, these mutations have not been further characterized. However, many of them are predicted to lead to truncated proteins that, presumably, are non-functional.
The incomplete form of X-linked congenital stationary night blindness (CSNB2) is caused by mutations in the CACNA1F gene, which encodes the voltage-gated calcium channel CaV1.4 expressed heavily in retina
. One of the important properties of this channel is that it inactivates at an extremely low rate. This allows it to produce sustained Ca2+ entry upon depolarization. As photoreceptor
s depolarize in the absence of light, CaV1.4 channels operate to provide sustained neurotransmitter release upon depolarization. This has been demonstrated in CACNA1F mutant mice that have markedly reduced photoreceptor calcium signals. There are currently 55 mutations in CACNA1F located throughout the channel, Table 2 and Figure 1. While most of these mutations result in truncated and, likely, non-functional channels, it is expected that they prevent the ability of light to hyperpolarize photoreceptors. Of the mutations with known functional consequences, 4 produce channels that are either completely non-functional, and two that result in channels which open at far more hyperpolarized potentials than wild-type. This will result in photoreceptors that continue to release neurotransmitter even after light-induced hyperpolarization.
Retina
The vertebrate retina is a light-sensitive tissue lining the inner surface of the eye. The optics of the eye create an image of the visual world on the retina, which serves much the same function as the film in a camera. Light striking the retina initiates a cascade of chemical and electrical...
l disorder. It has two forms, complete, also known as type-1 (CSNB1), and incomplete, also known as type-2 (CSNB2), depending on severity. In the complete form (CSNB1), there is no measurable rod cell
Rod cell
Rod cells, or rods, are photoreceptor cells in the retina of the eye that can function in less intense light than can the other type of visual photoreceptor, cone cells. Named for their cylindrical shape, rods are concentrated at the outer edges of the retina and are used in peripheral vision. On...
response to light, whereas this response is measurable in the incomplete form. Patients with this disorder have difficulty adapting to low light situations due to impaired photoreceptor transmission
Neurotransmission
Neurotransmission , also called synaptic transmission, is the process by which signaling molecules called neurotransmitters are released by a neuron , and bind to and activate the receptors of another neuron...
. These patients also often have reduced visual acuity, myopia
Myopia
Myopia , "shortsightedness" ) is a refractive defect of the eye in which collimated light produces image focus in front of the retina under conditions of accommodation. In simpler terms, myopia is a condition of the eye where the light that comes in does not directly focus on the retina but in...
, nystagmus, and strabismus
Strabismus
Strabismus is a condition in which the eyes are not properly aligned with each other. It typically involves a lack of coordination between the extraocular muscles, which prevents bringing the gaze of each eye to the same point in space and preventing proper binocular vision, which may adversely...
. CSNB1 is caused by mutations in the gene NYX
NYX (gene)
Nyctalopin is a protein that in humans is encoded by the NYX gene. It is a leucine-rich proteoglycan which is expressed in the eye, spleen and brain in mice. Mutations in this gene cause congenital stationary night blindness in humans. A mouse strain called nob carries a spontaneous mutation...
, which encodes a protein involved in retinal synapse
Synapse
In the nervous system, a synapse is a structure that permits a neuron to pass an electrical or chemical signal to another cell...
formation or synaptic transmission. CSNB2 is caused by mutations in the gene CACNA1F, which encodes a voltage-gated calcium channel CaV1.4.
Symptoms
The X-linked varieties of congenital stationary night blindness (CSNB) can be differentiated from the autosomal forms by the presence of myopiaMyopia
Myopia , "shortsightedness" ) is a refractive defect of the eye in which collimated light produces image focus in front of the retina under conditions of accommodation. In simpler terms, myopia is a condition of the eye where the light that comes in does not directly focus on the retina but in...
, which is typically absent in the autosomal forms. Patients with CSNB often have impaired night vision, myopia
Myopia
Myopia , "shortsightedness" ) is a refractive defect of the eye in which collimated light produces image focus in front of the retina under conditions of accommodation. In simpler terms, myopia is a condition of the eye where the light that comes in does not directly focus on the retina but in...
, reduced visual acuity
Visual acuity
Visual acuity is acuteness or clearness of vision, which is dependent on the sharpness of the retinal focus within the eye and the sensitivity of the interpretative faculty of the brain....
, strabismus
Strabismus
Strabismus is a condition in which the eyes are not properly aligned with each other. It typically involves a lack of coordination between the extraocular muscles, which prevents bringing the gaze of each eye to the same point in space and preventing proper binocular vision, which may adversely...
, and nystagmus. Individuals with the complete form of CSNB (CSNB1) have highly impaired rod
Rod cell
Rod cells, or rods, are photoreceptor cells in the retina of the eye that can function in less intense light than can the other type of visual photoreceptor, cone cells. Named for their cylindrical shape, rods are concentrated at the outer edges of the retina and are used in peripheral vision. On...
sensitivity (reduced ~300x) as well as cone
Cone cell
Cone cells, or cones, are photoreceptor cells in the retina of the eye that are responsible for color vision; they function best in relatively bright light, as opposed to rod cells that work better in dim light. If the retina is exposed to an intense visual stimulus, a negative afterimage will be...
dysfunction. Patients with the incomplete form can present with either myopia or hyperopia
Hyperopia
Hyperopia, also known as farsightedness, longsightedness or hypermetropia, is a defect of vision caused by an imperfection in the eye , causing difficulty focusing on near objects, and in extreme cases causing a sufferer to be unable to focus on objects at any distance...
.
Cause
CSNB was originally believed to be caused by malfunction in neurotransmission from rodsRod cell
Rod cells, or rods, are photoreceptor cells in the retina of the eye that can function in less intense light than can the other type of visual photoreceptor, cone cells. Named for their cylindrical shape, rods are concentrated at the outer edges of the retina and are used in peripheral vision. On...
to bipolar cell
Bipolar cell
As a part of the retina, the bipolar cell exists between photoreceptors and ganglion cells. They act, directly or indirectly, to transmit signals from the photoreceptors to the ganglion cells.-Overview:...
s in the retina. This is due to electroretinogram (ERG) measurements on CSNB patients which show a drastic decrease in the size of the scotopic b-wave in comparison to the a-wave, in CSNB2, or a complete loss of both in CSNB1. The a-wave is believed to represent the response of rods to visual input and remains largely unchanged in CSNB2 patients. The b-wave, however, is believed to result from electrical activity of bipolar cell
Bipolar cell
As a part of the retina, the bipolar cell exists between photoreceptors and ganglion cells. They act, directly or indirectly, to transmit signals from the photoreceptors to the ganglion cells.-Overview:...
s and is decreased or non-existent in both CSNB1 and 2. CSNB1 patients also show mildly altered cone activity. Further study has demonstrated that the defects found in CSNB patients are better explained by more general defects in both the rod and cone ON-signaling pathways.
CSNB1
The complete form of X-linked congenital stationary night blindness, also known as nyctalopiaNyctalopia
Nyctalopia is a condition making it difficult or impossible to see in relatively low light. It is a symptom of several eye diseases. Night blindness may exist from birth, or be caused by injury or malnutrition...
, is caused by mutations in the NYX gene
NYX (gene)
Nyctalopin is a protein that in humans is encoded by the NYX gene. It is a leucine-rich proteoglycan which is expressed in the eye, spleen and brain in mice. Mutations in this gene cause congenital stationary night blindness in humans. A mouse strain called nob carries a spontaneous mutation...
(Nyctalopin on X-chromosome), which encodes a small leucine-rich repeat
Leucine-rich repeat
A leucine-rich repeat is a protein structural motif that forms an α/β horseshoe fold. It is composed of repeating 20–30 amino acid stretches that are unusually rich in the hydrophobic amino acid leucine...
(LRR) family protein of unknown function. This protein consists of an N-terminal signal peptide and 11 LRRs (LRR1-11) flanked by cysteine-rich LRRs (LRRNT and LRRCT). At the C-terminus of the protein there is a putative GPI anchor site. Although the function of NYX is yet to be fully understood, it is believed to be located extracellularly. A naturally occurring deletion of 85 bases in NYX in some mice leads to the "nob" (no b-wave) phenotype, which is highly similar to that seen in CSNB1 patients. NYX is expressed primarily in the rod and cone cells of the retina. There are currently almost 40 known mutations in NYX associated with CSNB1, Table 1., located throughout the protein. As the function of the nyctalopin protein is unknown, these mutations have not been further characterized. However, many of them are predicted to lead to truncated proteins that, presumably, are non-functional.
| Mutation | Position | References | |
|---|---|---|---|
| Nucleotide | Amino acid | ||
| c.?-1_?-61del | 1_20del | Signal sequence | |
| Splicing | Intron 1 | ||
| c.?-63_1443-?del | 21_481del | ||
| c.48_64del | L18RfsX108 | Signal sequence | |
| c.85_108del | R29_A36del | N-terminal LRR | |
| c.G91C | C31S | LRRNT | |
| c.C105A | C35X | LRRNT | |
| c.C169A | P57T | LRRNT | |
| c.C191A | A64E | LRR1 | |
| c.G281C | R94P | LRR2 | |
| c.301_303del | I101del | LRR2 | |
| c.T302C | I101T | LRR2 | |
| c.340_351del | E114_A118del | LRR3 | , |
| c.G427C | A143P | LRR4 | |
| c.C452T | P151L | LRR4 | |
| c.464_465insAGCGTGCCCGAGCGCCTCCTG | S149_V150dup+P151_L155dup | LRR4 | |
| c.C524G | P175R | LRR5 | |
| c.T551C | L184P | LRR6 | |
| c.556_618delins | H186?fsX260 | LRR6 | |
| c.559_560delinsAA | A187K | LRR6 | |
| c.613_621dup | 205_207dup | LRR7 | , |
| c.628_629ins | R209_S210insCLR | LRR7 | |
| c.T638A | L213Q | LRR7 | |
| c.A647G | N216S | LRR7 | , |
| c.T695C | L232P | LRR8 | |
| c.727_738del | 243_246del | LRR8 | |
| c.C792G | N264K | LRR9 | |
| c.T854C | L285P | LRR10 | |
| c.T893C | F298S | LRR10 | |
| c.C895T | Q299X | LRR10 | |
| c.T920C | L307P | LRR11 | |
| c.A935G | N312S | LRR11 | |
| c.T1040C | L347P | LRRCT | |
| c.G1049A | W350X | LRRCT | |
| c.G1109T | G370V | LRRCT | |
| c.1122_1457del | S374RfsX383 | LRRCT | , |
| c.1306del | L437WfsX559 | C-terminus | |
| LRR: leucine-rich repeat Leucine-rich repeat A leucine-rich repeat is a protein structural motif that forms an α/β horseshoe fold. It is composed of repeating 20–30 amino acid stretches that are unusually rich in the hydrophobic amino acid leucine... , LRRNT and LRRCT: N- and C-terminal cysteine-rich LRRs. |
|||
CSNB2
Retina
The vertebrate retina is a light-sensitive tissue lining the inner surface of the eye. The optics of the eye create an image of the visual world on the retina, which serves much the same function as the film in a camera. Light striking the retina initiates a cascade of chemical and electrical...
. One of the important properties of this channel is that it inactivates at an extremely low rate. This allows it to produce sustained Ca2+ entry upon depolarization. As photoreceptor
Photoreceptor
A photoreceptor cell is a specialized type of neuron found in the eye's retina that is capable of phototransduction. The great biological importance of photoreceptors is that they convert light into signals that can stimulate biological processes...
s depolarize in the absence of light, CaV1.4 channels operate to provide sustained neurotransmitter release upon depolarization. This has been demonstrated in CACNA1F mutant mice that have markedly reduced photoreceptor calcium signals. There are currently 55 mutations in CACNA1F located throughout the channel, Table 2 and Figure 1. While most of these mutations result in truncated and, likely, non-functional channels, it is expected that they prevent the ability of light to hyperpolarize photoreceptors. Of the mutations with known functional consequences, 4 produce channels that are either completely non-functional, and two that result in channels which open at far more hyperpolarized potentials than wild-type. This will result in photoreceptors that continue to release neurotransmitter even after light-induced hyperpolarization.
| Mutation | Position | Effect | References | |
|---|---|---|---|---|
| Nucleotide | Amino Acid | |||
| R50X | ||||
| R51PfsX115 | ||||
| C74R | ||||
| R82X | ||||
| CCACCCCGTAGGGGTGCTCCACC S156VdelPinsGVKHOVGVLH |>D1S2-3 | | , , |
||||
| Splicing | ||||
| S229P | ||||
| G261R | ||||
| E278X | ||||
| R302AfsX314 | ||||
| F318del | ||||
| G369D | ||||
| W407GfsX443 | ||||
| Q439X | ||||
| R519Q | ||||
| R625X | ||||
| G674D | ||||
| R691X | ||||
| F753C | ||||
| I756T | ||||
| Splicing | ||||
| L860P | ||||
| R895X | ||||
| Splicing | ||||
| Splicing | ||||
| A928D | ||||
| R969X | ||||
| R972X | ||||
| Splicing | ||||
| R978X | ||||
| I1003del | ||||
| G1018R | ||||
| G1042AfsX1076 | ||||
| L1056PfsX1066 | ||||
| R1060W | ||||
| L1079P | ||||
| L1225SfsX1266 | ||||
| G1231_T1234del | ||||
| S1265I | ||||
| R1296S | ||||
| R1299X | ||||
| Splicing | ||||
| Q1359X | ||||
| L1375H | ||||
| Splicing | ||||
| W1451X | ||||
| C1499R | ||||
| P1500R | ||||
| L1508P | ||||
| Splicing | ||||
| F1528LfsX1535 | ||||
| K1602X | ||||
| R1827X | ||||
| S1888TfsX1931 | ||||
| R1930H | ||||