
Siamese Crocodile
Encyclopedia

Crocodile
A crocodile is any species belonging to the family Crocodylidae . The term can also be used more loosely to include all extant members of the order Crocodilia: i.e...
native to Indonesia
Indonesia
Indonesia , officially the Republic of Indonesia , is a country in Southeast Asia and Oceania. Indonesia is an archipelago comprising approximately 13,000 islands. It has 33 provinces with over 238 million people, and is the world's fourth most populous country. Indonesia is a republic, with an...
(Borneo
Borneo
Borneo is the third largest island in the world and is located north of Java Island, Indonesia, at the geographic centre of Maritime Southeast Asia....
and possibly Java
Java
Java is an island of Indonesia. With a population of 135 million , it is the world's most populous island, and one of the most densely populated regions in the world. It is home to 60% of Indonesia's population. The Indonesian capital city, Jakarta, is in west Java...
), Brunei
Brunei
Brunei , officially the State of Brunei Darussalam or the Nation of Brunei, the Abode of Peace , is a sovereign state located on the north coast of the island of Borneo, in Southeast Asia...
, East Malaysia
East Malaysia
East Malaysia, also known as Malaysian Borneo, is the part of Malaysia located on the island of Borneo. It consists of the Malaysian states of Sabah and Sarawak, and the Federal Territory of Labuan. It lies to the east from Peninsular Malaysia , which is located on the Malay Peninsula. The two are...
, Laos
Laos
Laos Lao: ສາທາລະນະລັດ ປະຊາທິປະໄຕ ປະຊາຊົນລາວ Sathalanalat Paxathipatai Paxaxon Lao, officially the Lao People's Democratic Republic, is a landlocked country in Southeast Asia, bordered by Burma and China to the northwest, Vietnam to the east, Cambodia to the south and Thailand to the west...
, Cambodia
Cambodia
Cambodia , officially known as the Kingdom of Cambodia, is a country located in the southern portion of the Indochina Peninsula in Southeast Asia...
, Burma, Thailand
Thailand
Thailand , officially the Kingdom of Thailand , formerly known as Siam , is a country located at the centre of the Indochina peninsula and Southeast Asia. It is bordered to the north by Burma and Laos, to the east by Laos and Cambodia, to the south by the Gulf of Thailand and Malaysia, and to the...
, and Vietnam
Vietnam
Vietnam – sometimes spelled Viet Nam , officially the Socialist Republic of Vietnam – is the easternmost country on the Indochina Peninsula in Southeast Asia. It is bordered by China to the north, Laos to the northwest, Cambodia to the southwest, and the South China Sea –...
. The species is critically endangered and already extirpated from many regions.
Common Names
Siamese crocodile, Siamese freshwater crocodile, Singapore small-grain, Cocodrilo de Siam, Crocodile du Siam, Buaja, Buaya kodok, Jara Kaenumchued, Soft-belly.Description
The Siamese crocodile is a small, freshwater crocodilian (a group that also includes alligators, caimans and the gharialGharial
The gharial , , also called Indian gavial or gavial, is the only surviving member of the once well-represented family Gavialidae, a long-established group of crocodilians with long, slender snouts...
), with a relatively broad, smooth snout and an elevated bony crest behind each eye. It is one of the most endangered crocodiles in the wild, although it is extensively bred in captivity.
Distribution
The historic range of the Siamese crocodile included most of Southeast Asia. This species is now extinct in the wild or nearly extinct from most countries except Cambodia. Formerly it was found in Cambodia, Indonesia (Borneo and possibly Java), Laos, Malaysia, Thailand, Vietnam, Brunei, and Burma.Habitat
Siamese Crocodile occurs in a wide range of freshwater habitats, including slow-moving rivers and streams, lakes, seasonal oxbow lakesOxbow Lakes
"Oxbow Lakes" is a single by ambient house artist The Orb. It featured remixes from artists such as Carl Craig, Sabres of Paradise and A Guy Called Gerald. It also includes an acoustic version performed by the string sextet Instrumental which was produced by Darren Allison. It reached number...
, marshes and swamp-lands . Most adults do not exceed 3 m (10 ft) in length, although there are hybrids in captivity that can grow much larger. Pure, non-hybridised examples of this species are generally unaggressive towards humans and unprovoked attacks are unknown.
Biology
Adults feed mainly on fish but may also eat amphibians, reptiles and small mammals . Very little is known about the natural historyNatural history
Natural history is the scientific research of plants or animals, leaning more towards observational rather than experimental methods of study, and encompasses more research published in magazines than in academic journals. Grouped among the natural sciences, natural history is the systematic study...
of this species in the wild, but females do appear to build mound-nests constructed from scraped-up plant debris mixed with mud . In captivity, these crocodiles breed during the wet season (April to May), laying between 20 and 50 eggs which are then guarded until they hatch . After incubation, the female will assist her young as they break out of their eggs and then carry the hatchlings to the water in her jaws .
Molecular Biology and Genetics
There are 3 barcode sequences available from BOLD and GenBankGenBank
The GenBank sequence database is an open access, annotated collection of all publicly available nucleotide sequences and their protein translations. This database is produced and maintained by the National Center for Biotechnology Information as part of the International Nucleotide Sequence...
. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GBGC4395-08|EF581859|Crocodylus siamensis| AATCGTTGACTTTTTTCCACTAACCACAAAGATATTGGCACCTTGTATTTTATTTTCGGAGCCTGGGCCGGAATAGTGGGCACAGCCATA---AGCCTATTAATCCGAACAGAACTCAGCCAGCCTGGCCCATTCATAGGAGAT---GACCAAATTTACAATGTTATCGTTACAGCACATGCCTTTATCATAATCTTCTTTATAGTTATACCAATCATGATCGGCGGATTTGGAAACTGACTACTTCCATTAATA---ATTGGAGCACCCGACATAGCATTCCCTCGCATAAACAACATAAGCTTCTGATTACTCCCCCCATCATTCACCCTACTTCTCTTTTCCGCCTTCATTGAAACCGGAGCTGGTACTGGATGAACAGTCTATCCACCCCTGGCTGGAAACCTAGCCCACGCCGGACCATCAGTAGACCTG---ACTATCTTCTCCCTTCACCTTGCTGGGGTATCATCCATCCTTGGAGCAATTAACTTTATTACCACGGCTATCAACATGAAGCCCCCAGCGATATCACAACAACAAACACCTCTTTTCGTGTGGTCTGTTCTAGTTACAGCCGTTCTCCTACTACTCTCACTACCAGTCCTAGCTGCA---GGAATTACCATACTACTCACCGACCGAAACTTGAACACCACCTTCTTTGACCCCGCAGGAGGAGGAGACCCAATCCTATACCAGCACCTTTTCTGATTTTTCGGCCACCCAGAAGTGTACATCCTTATCCTGCCAGGATTTGGAATGATCTCCCACGTAATTACTTTCTACTCAAGTAAAAAA---GAACCATTCGGCTACATAGGAATAGTTTGAGCCATGATGTCAATCGGCTTTCTTGGCTTCATCGTCTGAGCCCACCACATGTTTACAGTCGGAATAG
-- end --
Taxonomy ID: 68455
Genbank common name: Siamese crocodile
Inherited blast name: crocodiles
Rank: species
Genetic code: Translation table 1 (Standard)
Mitochondrial genetic code: Translation table 2 (Vertebrate Mitochondrial)
synonym: Crocodylus siamensis Schneider, 1801
Life History and Behavior
Despite conservation concerns, many aspects of C. siamensis life history in the wild remain unknown, particularly with regards to its reproductive biology.Status
Classified as Critically EndangeredCritically Endangered
Critically Endangered is the highest risk category assigned by the IUCN Red List for wild species. Critically Endangered means that a species' numbers have decreased, or will decrease, by 80% within three generations....
(CR) on the IUCN Red List
IUCN Red List
The IUCN Red List of Threatened Species , founded in 1963, is the world's most comprehensive inventory of the global conservation status of biological species. The International Union for Conservation of Nature is the world's main authority on the conservation status of species...
, and listed on Appendix I of CITES.
Threats
Siamese crocodiles are under threat from human disturbance and habitat occupation, which is forcing remaining populations to the edges of their former range. Extinct from 99% of its original range, the Siamese crocodile is considered one of the least studied and most crtically endangered crocodilians in the world. Although few wild populations remain, more than 700,000 C. siamensis are held on commercial crocodile farms in Southeast Asia.In 1992, it was believed to be extinct in the wild
Extinct in the Wild
Extinct in the Wild is a conservation status assigned to species or lower taxa, the only known living members of which are being kept in captivity or as a naturalized population outside its historic range.-Examples:...
or extremely close to being extinct in the wild. Since then, a number of surveys have confirmed the presence of a tiny population in Thailand (possibly numbering as little as two individuals, discounting recent reintroduction
Reintroduction
Reintroduction is the deliberate release of a species into the wild in zones formerly inhabited by said species but where it has disappeared from for a number of reasons, from captivity or relocated from other areas where the species still survives in...
s), a small population in Vietnam (possibly less than 100 individuals), and more sizable populations in Burma, Laos and Cambodia. In March 2005, conservationists found a nest containing juvenile
Juvenile (organism)
A juvenile is an individual organism that has not yet reached its adult form, sexual maturity or size. Juveniles sometimes look very different from the adult form, particularly in terms of their colour...
Siamese crocodiles in the southern Lao province of Savannakhet. There are no recent records from Malaysia, Brunei. There is known to be a significant population of the crocodiles living in East Kalimantan, Indonesia.
Habitat Degredation
Many river systems, including those in protected areas, have hydroelectric power dams approved or proposed, which are likely to cause the loss of approximately half of the remaining breeding colonies within the next ten years. Factors causing loss of habitat include: conversion of wetlands for agriculture, using chemical fertilizers, using pesticides in rice production, and an increase in the population of cattle.Exploitation and Fragmentation
Illegal capture of wild crocodiles for supply to farms is an ongoing threat, as well as incidental capture/drowning in fishing nets and traps. C. siamensis currently has extremely low and fragmented remaining populations with little proven reproduction in the wild.Conservation and Management
Yayasan Ulin (The Ironwood Foundation) is running a small project to conserve an important wetland habitat in the area which is known to contain the crocodiles. Most of them, though, live in Cambodia, where isolated, small groups are present in several remote areas of the Cardamom mountains, in the South west of the country, and also in the Vireakchey National Park, in the North East of the country.Fauna and Flora International is running a program in the district of Thmo Bang, Koh Kong province, where villagers are financially encouraged to safeguarding known crocodile nests. The Araeng river is considered to have the healthiest population of Siamese crocodiles in the world, although this may soon change after the completion of a massive dam in the Araeng river. Fauna and Flora international, in collaboration with several Cambodian government departments, is planning on capturing as many crocodiles as possible from this river and reintroducing them in another, ecologically suitable area, before the completion of the dam and the subsequent flooding of the whole area effectively renders their current habitat unsuitable. During the heavy monsoon period of June–November, Siamese crocodiles take advantage of the increase in water levels to move out of the river and onto large lakes and other local bodies of water, returning to their original habitat once water levels start receding back to their usual levels. It is believed that a smaller population also exists in the Ta Tay river, also in the district of Thmo bang.
Poaching is a severe threat to the remaining wild population in the area, with small specimens reaching hundreds of dollars in the black market, where they are normally taken into crocodile farms and mixed with other, larger species. The total wild population is unknown, since most groups are in isolated areas where access is extremely complicated. A number of captively held individuals are the result of hybridization with the saltwater crocodile
Saltwater Crocodile
The saltwater crocodile, also known as estuarine or Indo-Pacific crocodile, is the largest of all living reptiles...
, but several thousand "pure" individuals do exist in captivity and it is regularly bred at crocodile farms; especially in Thailand.
In the Bang Sida National Park in Thailand, near Cambodia, there is a project to reintroduce Siamese crocodile into the wild. A number of young crocodiles have been released into a small and remote river in the park, not accessible to visitors.
The Phnom Tamao Wildlife Rescue Center in Cambodia conducted DNA analysis of 69 crocodiles in 2009, and found that 35 of them were purebred C. Siamensis. Conservationists from Fauna and Flora International and Wildlife Alliance
Wildlife Alliance
Wildlife Alliance is an international non-profit wildlife and forest conservation organization with current programs and partnerships in Cambodia, Thailand, and the Russian Far East...
plan to use these to launch a conservation breeding program in partnership with the Cambodian Forestry Administration.
Priority Projects
"::High priority1. Status surveys and development of crocodile management and conservation programs in Cambodia and Lao PDR: These two countries appear to be the remaining stronghold of the species. Identifying key areas and populations, and obtaining quantitative estimates of population size as a precursor to initiating conservation programs is needed.
2. Implementation of protection of habitat and restocking in Thailand: Thailand has the best organized protected areas system, the largest source of farm raised crocodiles for restocking and the most developed crocodile management program in the region. Although the species has virtually disappeared from the wild, re-establishment of viable populations in protected areas is feasible.
3. Protection of crocodile populations in Vietnam: A combination of habitat protection and captive breeding could prevent the complete loss of the species in Vietnam. Surveys, identification of suitable localities and the implementation of a conservation program coordinated with the captive breeding efforts of Vietnamese institutions is needed.
4. Investigation of the taxonomy of the freshwater crocodiles in southeast Asia and the Indo-Malaysian Archipelago: The relationships among the freshwater crocodiles in the Indo-Malaysian Archipelago are poorly understood. The clarification of these relationships is not only of scientific interest but also has important implications for conservation.
-
- Moderate priority
1. Coordination of captive breeding, trade and conservation in the South east Asian region: Several countries in the region are already deeply involved in captive breeding programs for commercial use. Integration of this activity with necessary conservation actions for the wild populations (including funding surveys and conservation) could be a powerful force for conservation. A long term aim could be the re-establishment of viable wild populations and their sustainable use by ranching.
2. Maintain a stock of pure C. siamensis in crocodile farms: The bulk of the captive C. siamensis worldwide are maintained in several farms in Thailand where extensive interbreeding with C. porosus has taken place. Hybrids are preferred for their superior commercial qualities, but the hybridization threatens the genetic integrity of one of the most threatened species of crocodilians. Farms should be encouraged to segregate genetically pure C. siamensis for conservation, in addition to the hybrids they are promoting for hide production.
3. Survey and protection of Siamese crocodiles in Indonesia: Verification of the presence of C. siamensis in Kalimantan and Java is a first step to developing protection for the species within the context of the developing crocodile management strategy in Indonesia."