Guide RNA
Encyclopedia
Guide RNAs are the RNAs that guide the insertion or deletion of uridine residues into mitochondrial mRNAs in kinetoplastid
protist
s in a process known as RNA editing
.
s have a novel post-transcriptional mitochondrial RNA modification process known as "RNA editing". The mitochondrial genome in these cells consists of 20-50 maxicircles that encode genes and "cryptogenes" (and some gRNAs) and 10-20,000 minicircles that encode gRNAs. All of these molecules are catenated into a giant network of DNA that is situated at the base of the flagellum
in the inner compartment of the single mitochondrion.
A majority of the maxicircle transcripts can not be translated into proteins due to multiple frameshifts in the sequences. These frameshifts are corrected after transcription by the insertion and deletion of uridine
residues at precise sites which create an open reading frame that is translated into a mitochondrial protein homologous to mitochondrial proteins from other cells. The insertions and deletions are mediated by short guide RNA (gRNAs) which encode the editing information in the form of complementary sequences (allowing GU as well as GC base pairs). The gRNAs are transcribed from both the maxicircles and the minicircles.
The presence of two genomes in the mitochondrion, one of which contains sequence information that corrects errors in the other genome, is novel. Editing proceeds generally 3' to 5' on the mRNA. The initial editing event occurs when a gRNA forms an RNA duplex with a complementary mRNA sequence just downstream of the editing site. This then recruits a number of ribonucleoprotein
complexes that direct the precise insertions and deletions of uridine residues, thereby extending the duplex upstream. The adjacent upstream editing site is then modified in the same manner. A single gRNA usually encodes the information for several editing sites (an editing "block"), the editing of which produces a complete gRNA/mRNA duplex.
In the case of "pan-edited" mRNAs, the duplex unwinds and another gRNA then forms a duplex with the edited mRNA sequence and initiates another round of editing. The overlapping gRNAs form an editing "domain". In some genes there are multiple editing domains. The extent of editing for any particular gene varies between trypanosomatid species. The variation consists of the loss of editing at the 3' side, probably due to the loss of minicircle sequence classes that encode specific gRNAs. A retroposition model has been proposed to account for the partial, and in some cases, complete, loss of editing in evolution. Loss of editing is lethal in most cases, although losses have been seen in old laboratory strains. The maintenance of editing over the long evolutionary history of these ancient protists implies the presence of a selective advantage, the exact nature of which is still uncertain.
It is not clear why trypanosomatids utilize such an elaborate mechanism to produce mRNAs. It may have originated in the early mitochondrion of the ancestor of the kintoplastid protist lineage, since it is present in the bodonids which are ancestral to the trypanosomatids, and may not be present in the euglenoids, which branched from the same common ancestor as the kinetoplastids.
In the protozoan Leishmania tarentolae, 12 of the 18 mitochondrial genes are edited using this process. One such gene is Cyb. The mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is
mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3'
The 3' end is used to anchor the gRNA (gCyb-I gRNA in this case) by basepairing (some G/U pairs are used). The 5' end does not exactly match and one of three specific endonucleases cleaves the mRNA at the mismatch site.
gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5' A A AGAAA A G G C UUUAACUUCAGGUUGU 3'
The mRNA is now "repaired" by adding U's at each editing site in succession, giving the sequence
gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3'
This particular gene has two overlapping gRNA editing sites. The 5' end of this section is the 3' anchor for another gRNA (gCyb-II gRNA).
Kinetoplastid
The kinetoplastids are a group of single-cell flagellate protozoa, including a number of parasites responsible for serious diseases in humans and other animals, as well as various forms found in soil and aquatic environments...
protist
Protist
Protists are a diverse group of eukaryotic microorganisms. Historically, protists were treated as the kingdom Protista, which includes mostly unicellular organisms that do not fit into the other kingdoms, but this group is contested in modern taxonomy...
s in a process known as RNA editing
RNA editing
The term RNA editing describes those molecular processes in which the information content in an RNA molecule is altered through a chemical change in the base makeup. To date, such changes have been observed in tRNA, rRNA, mRNA and microRNA molecules of eukaryotes but not prokaryotes...
.
Overview of gRNA-directed editing
Trypanosomatid protists and other kinetoplastidKinetoplastid
The kinetoplastids are a group of single-cell flagellate protozoa, including a number of parasites responsible for serious diseases in humans and other animals, as well as various forms found in soil and aquatic environments...
s have a novel post-transcriptional mitochondrial RNA modification process known as "RNA editing". The mitochondrial genome in these cells consists of 20-50 maxicircles that encode genes and "cryptogenes" (and some gRNAs) and 10-20,000 minicircles that encode gRNAs. All of these molecules are catenated into a giant network of DNA that is situated at the base of the flagellum
Flagellum
A flagellum is a tail-like projection that protrudes from the cell body of certain prokaryotic and eukaryotic cells, and plays the dual role of locomotion and sense organ, being sensitive to chemicals and temperatures outside the cell. There are some notable differences between prokaryotic and...
in the inner compartment of the single mitochondrion.
A majority of the maxicircle transcripts can not be translated into proteins due to multiple frameshifts in the sequences. These frameshifts are corrected after transcription by the insertion and deletion of uridine
Uridine
Uridine is a molecule that is formed when uracil is attached to a ribose ring via a β-N1-glycosidic bond.If uracil is attached to a deoxyribose ring, it is known as a deoxyuridine....
residues at precise sites which create an open reading frame that is translated into a mitochondrial protein homologous to mitochondrial proteins from other cells. The insertions and deletions are mediated by short guide RNA (gRNAs) which encode the editing information in the form of complementary sequences (allowing GU as well as GC base pairs). The gRNAs are transcribed from both the maxicircles and the minicircles.
The presence of two genomes in the mitochondrion, one of which contains sequence information that corrects errors in the other genome, is novel. Editing proceeds generally 3' to 5' on the mRNA. The initial editing event occurs when a gRNA forms an RNA duplex with a complementary mRNA sequence just downstream of the editing site. This then recruits a number of ribonucleoprotein
Ribonucleoprotein
Ribonucleoprotein is a nucleoprotein that contains RNA, i.e. it is an association that combines ribonucleic acid and protein together. A few known examples include the ribosome, the enzyme telomerase, vault ribonucleoproteins, and small nuclear RNPs , which are implicated in pre-mRNA splicing and...
complexes that direct the precise insertions and deletions of uridine residues, thereby extending the duplex upstream. The adjacent upstream editing site is then modified in the same manner. A single gRNA usually encodes the information for several editing sites (an editing "block"), the editing of which produces a complete gRNA/mRNA duplex.
In the case of "pan-edited" mRNAs, the duplex unwinds and another gRNA then forms a duplex with the edited mRNA sequence and initiates another round of editing. The overlapping gRNAs form an editing "domain". In some genes there are multiple editing domains. The extent of editing for any particular gene varies between trypanosomatid species. The variation consists of the loss of editing at the 3' side, probably due to the loss of minicircle sequence classes that encode specific gRNAs. A retroposition model has been proposed to account for the partial, and in some cases, complete, loss of editing in evolution. Loss of editing is lethal in most cases, although losses have been seen in old laboratory strains. The maintenance of editing over the long evolutionary history of these ancient protists implies the presence of a selective advantage, the exact nature of which is still uncertain.
It is not clear why trypanosomatids utilize such an elaborate mechanism to produce mRNAs. It may have originated in the early mitochondrion of the ancestor of the kintoplastid protist lineage, since it is present in the bodonids which are ancestral to the trypanosomatids, and may not be present in the euglenoids, which branched from the same common ancestor as the kinetoplastids.
In the protozoan Leishmania tarentolae, 12 of the 18 mitochondrial genes are edited using this process. One such gene is Cyb. The mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is
mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3'
The 3' end is used to anchor the gRNA (gCyb-I gRNA in this case) by basepairing (some G/U pairs are used). The 5' end does not exactly match and one of three specific endonucleases cleaves the mRNA at the mismatch site.
gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5' A A AGAAA A G G C UUUAACUUCAGGUUGU 3'
The mRNA is now "repaired" by adding U's at each editing site in succession, giving the sequence
gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3'
This particular gene has two overlapping gRNA editing sites. The 5' end of this section is the 3' anchor for another gRNA (gCyb-II gRNA).